%PDF-1.5 % 1 0 obj <>>> endobj 2 0 obj <> endobj 3 0 obj <>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 4 0 R/Group<>/Tabs/S/StructParents 0>> endobj 4 0 obj <> stream xTMo@[#Db=+!$*U#%*U(DrdM*Hyv|WY ~tk&xγrf0a18MOƋ4!@(e:p aNe&>jS&,șxP -,PA< #̥K3՞Nim2MIGv{]סxǒFt1< K0yUaFyam[4EOz(0XD&%x-Jl#$#I=hEnkq&i#p-R?Dk->h#kmW))jy=f [! $!2J%oG HA%Wq>reu8=ۏk:slZ}>Y r0ca=]y[+ [ endstream endobj 5 0 obj <> endobj 6 0 obj [ 7 0 R] endobj 7 0 obj <> endobj 8 0 obj <> endobj 9 0 obj <> endobj 10 0 obj <> endobj 11 0 obj <> endobj 12 0 obj <> endobj 13 0 obj <> endobj 14 0 obj <> stream x]W׶nPpdAA(1('"Lg}FlbUҦ&ݻwj׼ܽv-Bzz:;k*p;11lmm'݋̝Ip xVvZ3%3 ֑jofZ OmQg`TyIŶmTza!cYkFs'r<%%a:m Gy65@w-t=H,Qnp0wz>}H0w|vmkYw|饗L1;;bstb_`6G#{`Ci*D3آ"?qk<Vfdpp?7ֵb>ܱ5Q&իW;^X͘UZU;&8m\ov;99CPTZ-x"[*sGm3M`m1r|}tt6Z8a(,Y6+q|ԻBFEEi LKK sθ;AP#'ׯ&wlk;a4RmB>&26&Վf^$k Q"[V,svZnp 5_N~T>i}nڴi7ß4YMc=1bFWXXhl888PFWs"j)JKw.DJ;@RR؜;&T Κg )))TZGzӧOȚ5k̚wd1t( RZq p7ݷ^mt s7:ac1wH N6[нpss#ȑ.F sǃ34 ;gϦZb2I&7vuc vw$yg0mÆ z#_|y||siy#MiDcfʉ\%vC@RK9rD6bd|, ME R%-uj~FU|,՟~ۺ/j/nZ@6w6o5f+\]]W7oh"{1LLL?Vġޘq;vQl`lV#P8:96m`WY琻_BYX@E%˻*s4lݵ9N˓JOkkLiii>!'dQ>KfXܹOάMeff"믳Bܡ␓'OY^f[n26Pv>>>zm0W EL_mm-UwT5Ep}γa$BOCCYa|T ʹeG9.0r+ŋj`WypyNnHHvcSȷ.@/ܺњjgRD{}#tk܌EDD rJS׽Q "q USS#) Pd(%Ctp0Ύ(YlBܽ;D9Sv۷o άA34t*rB T3oi yխq/XJrv JbMMrG8BC}b jz:wqC9tЕ+o#WPײւ;i";-[<MO[Oz\ !#a Q憨Lk(^h.]*\t)5n>?﷙/Gji)'w+#W梼<"++ Y(0 b^TFSϬ5w +j%ݦpS F,^~ahգ1oƌȑ7 rǓ1 J^!rlq-q`j.&(3o(^dkk[RRH(2:Vl1KƙPވ/̚L*2\䫏I $wБ«b!U^ȷ"E0`͚5?6o" ,i^z\%U*2遼#>)u;w}بgk BW?tD|;پ}u!D2j5?``P{cS/u!3߀h>*tI#9\ݮ_ Q?m6*-H| hE{ll_3gԻ>SxnbGxͱ0rȚN4CC;rQ\LT5t|{|􌉉1U&|ֵd)wrd[#|ѵK`u:W+U$pY~}n Ԏ)?r$+**hk}wøoN*'[26Źl޼YD|`ooNÓ>ƸRgy\c38Pǘ;3nl ֽM}y{{76V;h4wYJ'U%YDC5+W~2Eeww1wHޯ_?f+->=`“V\\L)8m]~I 1z}* ʗ,YbkТ>Lk]>`6Y5ڵ,Ił JJJ~;5s *4@r!L`;m>R%aDI3o?_'Xsqq1t}rWD PF= qx Օ`5F@v-^DjnM ̝$˨d}||ִ`rqnOuol17{ĸksgiiLB$NkZjnݺub[_&;۴i;w`Uҷ]{a4<ɘ&|dq89Î8nH+ɞdXSCL;rZݢEd;{“bDjXo:m,'w0)+ML4wO҇OҥKպؔӘ+;hVy[EJJ fŊ)ˇ]@@ԫ:N&; uWk.V=nFNHߵ$;_iI9mÆ {aNݿFgE{d$qǼ6oЅ)sq]ZZhx d )]zzhZ@I.,,`mmMT{R~>?;fnLAtNvvv2#p͘FD ujݸ#00h4G9b97mMΝqMj(?ׅJW5~5`P>w^rMF2sgw_ yCnz.wf"Rj ZF>@wTa }WEgJO:gO1pJf<ek(7z?~NntD%YFrWt uSĸ]aZ##/ GJll,3 ӬWu;SU2:/w&k:ui㻢 ̝^/^YiiiT]&pG5lmbb^(`0x{f$Dkyy3$UT#ɋ!ѫ endstream endobj 15 0 obj <> stream x}pT@6.IhA|)( v1+v$~8Bp\l#F3il%;ZʗbChm )c@&JR [!v  d$sz} =dϹ޳{NIL.u`dZBYTb_wR8w.\޽fZ{_nUZW1=Vȍ''Lq)S&0Tv3?,K@JQ?3cxJ Ӑ݌ݱ y ǘr>CNSl'11yVU}L,>PɧLcXínyyJ3 <ѷ 5\X߄JY eZDݞȈp+2);;q@Խ&gbgNf[4:mU>Jy.Oʰx-fbT/* &;D0MahpK/`:E!0eK}G$I7KQilKxhKW}h E#s'&e?/P/eiz;-gFR0l'oXt dmIy.nEDsI=y~֠XcDtD'/w 79$uS67j]@l& $(vy3X~d:&ϋo+rњ7RqPJV*LDŶeԓI"k`O\ r~We:ڲG6lÚqm5d}=/2fIB4`}v< ʦ2lŨEdurj%.s.hVkcRSX7ޡ Z=\i6$N;{}]zhN1$yՊd4knHj߉ʊ|Tx8 NObGdqN0@YIvg~TrdgGkI$:l|hUF% q$:<'sx4t*[Hy5">ZNZ;"nw}O/rPiAl$,S\1ʄx{.,jʚIou5,!=7>h8f+B2ՑT_O8xD9 .bݹoFɥXM &yQξ(4u/.!N^z9ˍQT<˨^L%D9[˧׷t)w9&-۶W1yTarqK_E0vli˞{> b*=nۘܟPr=E*z1fQ%T#62%81bi|\?[ `ٷg?<ZP&t6]PSP6l>K hf#SvS/B>;j)W6@V z#m5< f0 TIQ{\W89AhYr?Z?A'?jq~!5/WUn//;^T* *Mq>CwhRn,һ]W<7==(w\R,JwfJTeZ$L:I29˔mI4q1}<$%)IIJR'ɠSBõgz9$l~sHCt|Hx<^`< a_ 4& 7QXjP0Jv>p<A$߸I/Dzz2h؞HS%A,N[^ff9J3W:GjKf[ji[{y XL\UwL1xXH7|,ajondӓF84J]O7n&9䠬鸺jhP#ˈ9noSk.!hLgL[Iwҏir=bwmfOCͻH99RfQ{B&Y{I{Z'ƫx*|L2%ڮĪt֕}LWNH{qoxlYIຂŸa`3t8s;Yd QL년g>XqmLbAfTpwv_gZFE$8j0M$)IIJR4f endstream endobj 16 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 17 0 R/Group<>/Tabs/S/StructParents 1>> endobj 17 0 obj <> stream xXKkHXS] e dl0ߪn)I0-t㫪Js~>?=|<:>wq{p߷ûO>>?-~w~Z\Zw_;(>oD$4Uy֠km#QxPߵ*SglXWpPs#RE\%+R裁UlǺvKk#S &7PB0 OUx|S|3T Oe(tӛ~Wop!e),?tD?yعdQqx'm~2 dCT8K2n?[2B4@7V@Qd3Zv%H+j+8+Gr]qG(+VVNFVFV[ɅL Bvia*&sbJ*XK&rLRԷ7 QWA Қ*t˪),cR*m6|6,D - 3Bi)"&6$MMx-BjliQr2vI568p]IX`-j|Zu4ggsj8L %J5ik%Add(Y t9Ӫiso5.&՛aW˥/KZMq44uM{Q5N+ghvT}E5JQ*tΡ'6i_YҌH#~N-F ?QUF5*wh+5 2znF_u߂yl XȊaڜ 12NV̀y%7Wae)IT©§M3pIGE>/(''4'':Q%Xp2L0[Hԯ)IT%; x :{q ep M8[G%nf\!^ürF_c}]knobη:Λ$403Yn"A'Tm+7FU]V]VzlE/"!h̫;#{ QҎ;ט9VI:4;=:ɾQ۵Ԅjrٹۻk^\EZ_x|x-h,w++S0.SPok.IKY[ʖAo0Y4pCs=}McAp<13m{m16ⳚkCKZR &rԢyWs-®6<0p&D3 L.H7<]$dڋAC+.3RC=bu23*PBiUȱ+N^.˽!Rnu|N'|iLp&MVڗ -W]L Yn Nam9a-T*;g:6 endstream endobj 18 0 obj <> endobj 19 0 obj [ 20 0 R] endobj 20 0 obj <> endobj 21 0 obj <> endobj 22 0 obj <> endobj 23 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/Annots[ 25 0 R 28 0 R 31 0 R 35 0 R 39 0 R 49 0 R 62 0 R 69 0 R 71 0 R 74 0 R 76 0 R] /MediaBox[ 0 0 595.32 841.92] /Contents 24 0 R/Group<>/Tabs/S/StructParents 2>> endobj 24 0 obj <> stream x]k[9 YF_^vBKEE^4iaI"Es81#陑m~th./p韻m~z{putCtvk?Wp)513)oo/W7bި䲓zt[΍y+jđfRr7qFo@^8Z3c-rgp`[zcT)i֩&#θӜF9P4y^Ks? RL4-2pfz o9|qf'h쎒K'7:joC'/s6/aSV!5"\}dʪhgD!YXQbZŊ$>|)> λfe%zZK^藹U9LL|gT=|~*Shwp.\uˡZ+UrSqrә,0q4φUULFO*iDA혫Tº…hqjC<[E K燋d`xg- spnnPM'76=ϡ]@uTwiJp;l;i`'M-C{33q:GOZh%~cįXU"fҾ :B7x/Gl9xC?hA5@a:" *BT,~W'Ϯb&n-̲;U9*P@TXVf9"QxG|# uߊZRVТ^qSC ׵RZZ޹|33BJ& t sJD\TNUuj]tb7~kooƿ O;!wYieKewutݩWtj GCFA8=q,kz!}S9$ٝ5Xqb+;+_2ڬ!eN_4qsuL_W+ujsS8qmq7cQ? Hqbu2C?^CR?c`$W墕;oHonK#2rΞȢ@g+{4~+K&c_?&i} F{ѕ@N |SOjTIC%co)91ykop55Yd|,SCeyjDڧJў8m[|Tpʊ8v;2DZB7xT?kmW|mWTm9urBx >|R`'A1l9u-@|̳Y Dx!!'lG|/M ;PI$&C>-Lp\"^8/'O>5wPU!3hX@ho!]J^)`,EE endstream endobj 25 0 obj <>/F 4/Dest[ 16 0 R/XYZ 54 769 0] /StructParent 3>> endobj 26 0 obj <> endobj 27 0 obj <> endobj 28 0 obj <>/F 4/Dest[ 30 0 R/XYZ 54 769 0] /StructParent 4>> endobj 29 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 165 0 R/Group<>/Tabs/S/StructParents 14>> endobj 30 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 166 0 R/Group<>/Tabs/S/StructParents 15>> endobj 31 0 obj <>/F 4/Dest[ 34 0 R/XYZ 54 769 0] /StructParent 5>> endobj 32 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 172 0 R/Group<>/Tabs/S/StructParents 16>> endobj 33 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 173 0 R/Group<>/Tabs/S/StructParents 17>> endobj 34 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 176 0 R/Group<>/Tabs/S/StructParents 18>> endobj 35 0 obj <>/F 4/Dest[ 38 0 R/XYZ 54 769 0] /StructParent 6>> endobj 36 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 177 0 R/Group<>/Tabs/S/StructParents 19>> endobj 37 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 178 0 R/Group<>/Tabs/S/StructParents 20>> endobj 38 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 179 0 R/Group<>/Tabs/S/StructParents 21>> endobj 39 0 obj <>/F 4/Dest[ 48 0 R/XYZ 54 769 0] /StructParent 7>> endobj 40 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 180 0 R/Group<>/Tabs/S/StructParents 22>> endobj 41 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 181 0 R/Group<>/Tabs/S/StructParents 23>> endobj 42 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 182 0 R/Group<>/Tabs/S/StructParents 24>> endobj 43 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 183 0 R/Group<>/Tabs/S/StructParents 25>> endobj 44 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 184 0 R/Group<>/Tabs/S/StructParents 26>> endobj 45 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 185 0 R/Group<>/Tabs/S/StructParents 27>> endobj 46 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 186 0 R/Group<>/Tabs/S/StructParents 28>> endobj 47 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 187 0 R/Group<>/Tabs/S/StructParents 29>> endobj 48 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 188 0 R/Group<>/Tabs/S/StructParents 30>> endobj 49 0 obj <>/F 4/Dest[ 61 0 R/XYZ 54 769 0] /StructParent 8>> endobj 50 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 189 0 R/Group<>/Tabs/S/StructParents 31>> endobj 51 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 190 0 R/Group<>/Tabs/S/StructParents 32>> endobj 52 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 191 0 R/Group<>/Tabs/S/StructParents 33>> endobj 53 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 192 0 R/Group<>/Tabs/S/StructParents 34>> endobj 54 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 193 0 R/Group<>/Tabs/S/StructParents 35>> endobj 55 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 194 0 R/Group<>/Tabs/S/StructParents 36>> endobj 56 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 195 0 R/Group<>/Tabs/S/StructParents 37>> endobj 57 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 196 0 R/Group<>/Tabs/S/StructParents 38>> endobj 58 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 197 0 R/Group<>/Tabs/S/StructParents 39>> endobj 59 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 198 0 R/Group<>/Tabs/S/StructParents 40>> endobj 60 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 199 0 R/Group<>/Tabs/S/StructParents 41>> endobj 61 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 200 0 R/Group<>/Tabs/S/StructParents 42>> endobj 62 0 obj <>/F 4/Dest[ 68 0 R/XYZ 54 769 0] /StructParent 9>> endobj 63 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 201 0 R/Group<>/Tabs/S/StructParents 43>> endobj 64 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 202 0 R/Group<>/Tabs/S/StructParents 44>> endobj 65 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 203 0 R/Group<>/Tabs/S/StructParents 45>> endobj 66 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 204 0 R/Group<>/Tabs/S/StructParents 46>> endobj 67 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 205 0 R/Group<>/Tabs/S/StructParents 47>> endobj 68 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 206 0 R/Group<>/Tabs/S/StructParents 48>> endobj 69 0 obj <>/F 4/Dest[ 70 0 R/XYZ 54 769 0] /StructParent 10>> endobj 70 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 207 0 R/Group<>/Tabs/S/StructParents 49>> endobj 71 0 obj <>/F 4/Dest[ 73 0 R/XYZ 54 769 0] /StructParent 11>> endobj 72 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 208 0 R/Group<>/Tabs/S/StructParents 50>> endobj 73 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 209 0 R/Group<>/Tabs/S/StructParents 51>> endobj 74 0 obj <>/F 4/Dest[ 75 0 R/XYZ 54 769 0] /StructParent 12>> endobj 75 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 210 0 R/Group<>/Tabs/S/StructParents 52>> endobj 76 0 obj <>/F 4/Dest[ 164 0 R/XYZ 54 769 0] /StructParent 13>> endobj 77 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 211 0 R/Group<>/Tabs/S/StructParents 53>> endobj 78 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 212 0 R/Group<>/Tabs/S/StructParents 54>> endobj 79 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 213 0 R/Group<>/Tabs/S/StructParents 55>> endobj 80 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 214 0 R/Group<>/Tabs/S/StructParents 56>> endobj 81 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 215 0 R/Group<>/Tabs/S/StructParents 57>> endobj 82 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 216 0 R/Group<>/Tabs/S/StructParents 58>> endobj 83 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 217 0 R/Group<>/Tabs/S/StructParents 59>> endobj 84 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 218 0 R/Group<>/Tabs/S/StructParents 60>> endobj 85 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 219 0 R/Group<>/Tabs/S/StructParents 61>> endobj 86 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 220 0 R/Group<>/Tabs/S/StructParents 62>> endobj 87 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 221 0 R/Group<>/Tabs/S/StructParents 63>> endobj 88 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 222 0 R/Group<>/Tabs/S/StructParents 64>> endobj 89 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 223 0 R/Group<>/Tabs/S/StructParents 65>> endobj 90 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 224 0 R/Group<>/Tabs/S/StructParents 66>> endobj 91 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 225 0 R/Group<>/Tabs/S/StructParents 67>> endobj 92 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 226 0 R/Group<>/Tabs/S/StructParents 68>> endobj 93 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 227 0 R/Group<>/Tabs/S/StructParents 69>> endobj 94 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 228 0 R/Group<>/Tabs/S/StructParents 70>> endobj 95 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 229 0 R/Group<>/Tabs/S/StructParents 71>> endobj 96 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 230 0 R/Group<>/Tabs/S/StructParents 72>> endobj 97 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 231 0 R/Group<>/Tabs/S/StructParents 73>> endobj 98 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 232 0 R/Group<>/Tabs/S/StructParents 74>> endobj 99 0 obj <>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 235 0 R/Group<>/Tabs/S/StructParents 75>> endobj 100 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 288 0 R/Group<>/Tabs/S/StructParents 76>> endobj 101 0 obj <>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 289 0 R/Group<>/Tabs/S/StructParents 77>> endobj 102 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 328 0 R/Group<>/Tabs/S/StructParents 78>> endobj 103 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 329 0 R/Group<>/Tabs/S/StructParents 79>> endobj 104 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 330 0 R/Group<>/Tabs/S/StructParents 80>> endobj 105 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 331 0 R/Group<>/Tabs/S/StructParents 81>> endobj 106 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 332 0 R/Group<>/Tabs/S/StructParents 82>> endobj 107 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 333 0 R/Group<>/Tabs/S/StructParents 83>> endobj 108 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 334 0 R/Group<>/Tabs/S/StructParents 84>> endobj 109 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 335 0 R/Group<>/Tabs/S/StructParents 85>> endobj 110 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 338 0 R/Group<>/Tabs/S/StructParents 86>> endobj 111 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 339 0 R/Group<>/Tabs/S/StructParents 87>> endobj 112 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 340 0 R/Group<>/Tabs/S/StructParents 88>> endobj 113 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 341 0 R/Group<>/Tabs/S/StructParents 89>> endobj 114 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 342 0 R/Group<>/Tabs/S/StructParents 90>> endobj 115 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 343 0 R/Group<>/Tabs/S/StructParents 91>> endobj 116 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 344 0 R/Group<>/Tabs/S/StructParents 92>> endobj 117 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 345 0 R/Group<>/Tabs/S/StructParents 93>> endobj 118 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 841.92 595.32] /Contents 346 0 R/Group<>/Tabs/S/StructParents 94>> endobj 119 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 841.92 595.32] /Contents 347 0 R/Group<>/Tabs/S/StructParents 95>> endobj 120 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 348 0 R/Group<>/Tabs/S/StructParents 96>> endobj 121 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 349 0 R/Group<>/Tabs/S/StructParents 97>> endobj 122 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 350 0 R/Group<>/Tabs/S/StructParents 98>> endobj 123 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 351 0 R/Group<>/Tabs/S/StructParents 99>> endobj 124 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 352 0 R/Group<>/Tabs/S/StructParents 100>> endobj 125 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 353 0 R/Group<>/Tabs/S/StructParents 101>> endobj 126 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 354 0 R/Group<>/Tabs/S/StructParents 102>> endobj 127 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 355 0 R/Group<>/Tabs/S/StructParents 103>> endobj 128 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 356 0 R/Group<>/Tabs/S/StructParents 104>> endobj 129 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 357 0 R/Group<>/Tabs/S/StructParents 105>> endobj 130 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 358 0 R/Group<>/Tabs/S/StructParents 106>> endobj 131 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 359 0 R/Group<>/Tabs/S/StructParents 107>> endobj 132 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/Annots[ 361 0 R] /MediaBox[ 0 0 595.32 841.92] /Contents 360 0 R/Group<>/Tabs/S/StructParents 108>> endobj 133 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 362 0 R/Group<>/Tabs/S/StructParents 110>> endobj 134 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 363 0 R/Group<>/Tabs/S/StructParents 111>> endobj 135 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 364 0 R/Group<>/Tabs/S/StructParents 112>> endobj 136 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 365 0 R/Group<>/Tabs/S/StructParents 113>> endobj 137 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 366 0 R/Group<>/Tabs/S/StructParents 114>> endobj 138 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 367 0 R/Group<>/Tabs/S/StructParents 115>> endobj 139 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 368 0 R/Group<>/Tabs/S/StructParents 116>> endobj 140 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 369 0 R/Group<>/Tabs/S/StructParents 117>> endobj 141 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 370 0 R/Group<>/Tabs/S/StructParents 118>> endobj 142 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 371 0 R/Group<>/Tabs/S/StructParents 119>> endobj 143 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 372 0 R/Group<>/Tabs/S/StructParents 120>> endobj 144 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 373 0 R/Group<>/Tabs/S/StructParents 121>> endobj 145 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 374 0 R/Group<>/Tabs/S/StructParents 122>> endobj 146 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 375 0 R/Group<>/Tabs/S/StructParents 123>> endobj 147 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 376 0 R/Group<>/Tabs/S/StructParents 124>> endobj 148 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 377 0 R/Group<>/Tabs/S/StructParents 125>> endobj 149 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 378 0 R/Group<>/Tabs/S/StructParents 126>> endobj 150 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 379 0 R/Group<>/Tabs/S/StructParents 127>> endobj 151 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 380 0 R/Group<>/Tabs/S/StructParents 128>> endobj 152 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 381 0 R/Group<>/Tabs/S/StructParents 129>> endobj 153 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 382 0 R/Group<>/Tabs/S/StructParents 130>> endobj 154 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 383 0 R/Group<>/Tabs/S/StructParents 131>> endobj 155 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 384 0 R/Group<>/Tabs/S/StructParents 132>> endobj 156 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 385 0 R/Group<>/Tabs/S/StructParents 133>> endobj 157 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 386 0 R/Group<>/Tabs/S/StructParents 134>> endobj 158 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 387 0 R/Group<>/Tabs/S/StructParents 135>> endobj 159 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 388 0 R/Group<>/Tabs/S/StructParents 136>> endobj 160 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 389 0 R/Group<>/Tabs/S/StructParents 137>> endobj 161 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 390 0 R/Group<>/Tabs/S/StructParents 138>> endobj 162 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 391 0 R/Group<>/Tabs/S/StructParents 139>> endobj 163 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 392 0 R/Group<>/Tabs/S/StructParents 140>> endobj 164 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 393 0 R/Group<>/Tabs/S/StructParents 141>> endobj 165 0 obj <> stream x[;9v``^=Xgۇ&MX"]cCϿO9/?~Nt~򧏿}O,?Ii&fOֳI޾a_~LW\ɋ47δ}ǿ}swq޺I<3O>цY1o\ w7srt1u`M({MI{=)qrJLLtn֓8YgNʩɟd_oߜ^~ pXMO>YRwUۋ#:>_n'jMu˄YnY[\_W6/~˙)7*WOq)ܺ\H] ;kcOFIOq @4^ubߘ-6B.:,^ۦjar?W'c$^QHpmnqa߹I΅2"+W#C\ nS#z(^ӏ{i#[6{)&.$txFN"^QF㼄Û{m&kGq`3ً>|7Ct f;ѐoqfR'b7[(>u.$" J ?\週GIu~{J&X?h\*l.e5fF=3]ժ$`xl Ϸ\L6l'9M 0jkk(N2yUay_%v7;u" 躈HqNNH ̑u?5\bb # #SL!DABn2 2:mљ(ȀuT :sˌNTH (\9z,ݽP2kx~t6sk fP7 LV˞6^+L6W \l] )Y)6ZRr;IXl5)sCJ )Y%)JJIxfb-$@!H(%CJe@WR6\JJz(LIqe)mܒRYJK@ǜ~g3)* ?-D+1<| -`3chmv֖ V[NqH8Wp,6QڇXX 1ی G%*QɊBSL;M;wc܋-;WwKL1+c)4FPơu?Q!xTCgc.%D~Jp6tjGj:Q7gBS5ShLci^j&kl-fԨ`v]3+x6 ,BWK[ƹg -Hm;,fDܒR6pMƷzo1o iڅFJG)$_H޺qEmzKKRIEҴWBS#BhzPMGSHLS0[&A5ifijRo}4l;3~p~7@c@ٛ4,pblFbiivtMj֦ 6iUi6jdCMe}OiIMewȨ63LݮB\pg@K~8']X3I!2IGRZRo@=$T̄ RS=BJeYܒ4 BKUsOiJKU"݅~9JRJSHz y.& |f3rM7,ogy׮Y$R)K .U?*ĢѺ4`ui!ԥ>$ե(EIʵc>a-aHچEK< PLґu?T7GT;HP8I;)$; RS*I fqK$&1@)&V7N҇u^3M'YޣT;Ԅk辘+LcC:P|3t4Y tEՀ+H} W>-6T)>uԧO >1A%>5-JU!~;0yeq? .R Pґu?4KP8J;Y)(5;3 Ss PR0u[&AEi *MIE7qTfggWj??/(8,ӹH7",nstn ]@P Eh!=EHz" Eh!>F?[o"ݢd"~Ak^u)+nqJeU᲍mA^ C=~mJ-i7q\piidB.wT% . 5gDp8.$J%%lFB>AwܡәwqB&.t"ݔlsCb5@g Fg4%Xi6Jӵg I$*bTنPiҒTiz7 Ct"Ms\;> .ZAzet!T9v(UYzFJA !<;{T*LIBÇJSR"op7fJ:ߟ:RZu& X7e8t3Y\BйWA x5ՆTu,"=vQ"F#*MIq_$8FiDlYO@m!j#EZD8H@Ԕv `7NN\ϟ~ʘcI˕9 q Ҥ L"CJ[ҡD;Eq>a2)<&x:̀s gk788KW8JI?YW ՈtC2KXݙlJKJ)xiwrS\W ¼^"Giá@lc!e Y3;o!J-Iu3NNV 1ά8;T*LIq)xsQiJ;7qVj*ɡ:Yeؙb& pLzџE$u GѹX ЉtSF ε +H W,6S0"'=ҙ d3^>t Qݢ"^[3zf3*;QH*w!T1dd/|vxiIO3UyƑKJ@ܙ*!rwR*#|mNWYlsS|ʝb76I GOrgz'𥤃LǷFQX Pt*=@ jEde6Hj!Чl+ߦrS+&տŠm kJW[7:2v?=[Mvܿ~yQ;1P2TA!X*@2'ß˥8h ]jSZSѨgҝ$H~&Dt~*kHoV azZ6H i;lNиoV&H3_=l>Y|pz)ӷӧgn?[4/z==SO`o\.wkOpS.}g24 6?|42Θιa0 i.?^ίOcer(~1]:> 2Qy>~zQXgEſ}91$`Z݆W~8vH5WgW…h]+6d}uW:/xVguM7´uL=j.Yfφ;rNwVj|7ߕ|U7/,e΂KE˾\J+^;FV< z?Ho+񤪦6eȾXTC~fSzv_YY쵕+Ϊ!{T ٫kSY9~Mo,=pf,-65nĻ۸Zmioc7>OE +'j~i endstream endobj 166 0 obj <> stream x][~pgLwa5Ɖ`APdcCb}&"OK°t#<|O?{|緿oǟ>/߼9.W78^19uPL9W߿..A 3#0ϚeHWWkj1G3sˉI>G~u.s)'/ut?_$ Gui8T1$e!rW'2# aAs:zW5xBL<7xӧ_~ry'/La.D6٣/ߜj- &#bdRr!k _@ ?>(U CYY*fb*6۹:r/#7coO'2o'r<-׸ntM7B29-PIۑ1KO}`5z͢@Ym_Ip5Q&<܀ZI^*!!|yBCN˝<艊Yd' PNm44DzaVJwS+XnP+o5TF zU{,+jgbu<\9EK`̍xٞh%8U*-Ffpzyb?R9-\ _-n dz [ȫ,ۺ?!ZW]%=j-8M\'J ) ;8,EO\ IMŜ.-6](cøy5PMMG˭b2 3HF,+wMW09`MBb%Pr0s\V50;w:GB99+=xN=sr;Q7o{5ʻ=́!\P5H0{o]I"Ǥ0<:#i%LusmJVZIZp8Ci3˅"v]sa$ Ju&/1o)j@|DU ^ĨV/ P75 'RZ'KHA-X&4˪,΍}ᓛ٥DDPa9a.1K.T[ # Jֹ9ص%b[6UƁNη $*4N@v̢g x7.cu'Ir jI({k 䘷FdlI3M2mY>nr5^ǯ}Gil\ 'p.pzW3{dGV~-3A݃}Gj67MLi-5QE6䃄Hq@ch[iKx;A"I`t)*ԧ2hI4lQteB 0r/Ԛ].v,y}+'%dE.[s]ȥ#R{Rp8a<[+^;*JDΔ,"с?DMVAKzVT}n/@}PN|Ñ:R A66%eDnc┾۳f ,-T7ƧEЊ#KNG(fHՍS6 D@5-g=,Q--#vW"љ7m;"){0TY9 2V}^?$Ufڎkת8vͤ3cPfonwst5 ح7jA#*CTUl9suR(p- /daXER'BCIvNF[hCv3) >@ Q'Q-+jQd"BX)4tO˗bE/ciYymeԗnF3E#Y}/d;2l}8uOˏ+Qc,Nd~Jl%3 E&0M-Bm z֒YHPT}@e)WS; 4|l2#@L:r'zMB3ka-Gfz,ZN)$\$!Uύ8z[24AѤ0ddfE}q2ڝXsʎ!F nUC| %vJY GG?#HIZe`5MZݳnw tpW{|Nt6%ݝ]>stIӪݝV.vN+ {&?{!V*lsUC5є` UyfYch x7CYcZ[d`5"C[ U^4]e-GV YV1m\c@')8%en CcB $ff,[g3ٟrݘ{i(m'}CqV.3r;eZfBQ-_z&|Y>,.;8eJ]~T.)*Twvy]T=Q ?˛/!nfG 9 ]^]jKuj_ѓ D&3xgӃ=AUEdw>hVV#j&3ZkO܃mgnDLVmax%iX6 OϨw J2A"Wc#NȕTq~*3U IgW"'g[cgXY<*7&ϗb֛y4 ѮBÕdᤡ/yͮYVgFϺg ǬL볺~m/+n;=`u>W=MAnU'[h6E{i"=UEvɬ)q7֖.o~<* pD2!\NaXMnBXJz|ˡu,>͢\w:[ J`и Z&3S40g=2: 76ζP6~#'6퇏=c]kYw~zg.)&wuUY`Tec} UG*;\mES5٦+GS D4Ktt#hى^x7CL$JjΧ ,D2D4$UQE0^lу;lK8_Q.ph593&!2>r@x>>_#{>Y"e j%Lj}䈅%%KO4A8 W#{K')a+/ Awt;=ku쯙 ./W8\0aA#؋mop7r}01<> SEbQ|,"N4iw0Y Sn9)_晻ͿBC׀fHZ4@f\2JOB)׏R046֠x4øwa2p6cKǗZ#ܬn7c sB,GG-εKtyG&9> W,AvI91ƒm$#,fCuIuc s}zW+QJZ'vl`w h;DK'QwZOb wDʻ#$=ĘzRcp& '1gkmL׸/(&n80~]h8z㉋Aw/ 腀;挹cː_ WY5ѠŪӪ蘿0 Qr/3Jpd+O18[O1++OI endstream endobj 167 0 obj <> endobj 168 0 obj [ 169 0 R] endobj 169 0 obj <> endobj 170 0 obj <> endobj 171 0 obj <> endobj 172 0 obj <> stream x]K%Gr78CkPW<5<0m$k1hh0άwFf0{oEEDFdF|p_~ϗ?\??/}_~/7~}z+˧޾G/苶doߐ~滏DT{gN%=[q7h{'Wf߾yqq'ڸ}}^#_w`y* 6m  b!U_bnzfST쒩{1i&vo.I6"l o|Oˇo}_1&"(*U+h]><.$=^jS⢥=k)̵ oۏ9j\>zP;] eKFLxf/wMf[JK-V=D9:H"`["&<0 I6_Vy"={APc[!態W*JjjMU @GhH?}TZh^IvR4E|-g%L"jp8?:*Lr Ch[#Fh9e= 4XI0LpѹS~\."f׀N$L٪ʀWK=S{'h*mO8 DJ=ז\*['ʠN")q,tՙ[LoQ\XXL b AݥKuUO.3J,NUNS='0Ww $0P|pI8ɐ"/mI?ys Ne iaeQgvS"5TvȞaN`܇K4 }ΉI,b4/?x s^T|P\v.̝͑wd~|KMQ*g ]W qupЛ곬Sq"l>8LM|0TUX!05B`B7$'q9m#J9.BuՉmk$hb} ۖDؚGJl a*-.%ꉏx`"8-b/ps k3?!bE,'qBsz6`- `0*v,` uy|?6 _^݁Nfapր8\6z*TͅTB=D *Al*٭Uʼ/i<@%.D_{(o1ѓ$u0g:ӡtϡ9QhŌvhb6YU0}BlTOZgL̺C) ZDZ |p`h1c5F8 VZh1xV,w B3ܝQ(M6:G8foꙑgB=Ss%'ʹ[\,VlgRnP<ڝ ~RXl"Kpfhm p*dGٴe븈]]A?_bYP;cSIĬ&$>*W<ԪTaOMARFz8]5ki.06e]cRpU-sE' S nM{+Vk-L{O՞J,()hD=b X (UUy >*"|H@N\8| `XBi@HTX_B2fs 7,^bQ,SQN FdA,B9'r(k psq\OϺDE$V|VC;' (9Y煳 -7|/ׇPgբzÆ!r0fP'#a%:YtUsv&`g\68Z? xc#A'~O&2g }oRT<%0(&䀧 SIP~2*čhqXr(2*ǽb3H z`b#{Tfxˍ?$bD/RrIό:gn)B}qM"8aJؽ+tXmFe5[3 P7l,ق 4\ o3E-L[ ƥ4 i|xz*q`6nvzra9cp&UKe U~SF'Whq } -{h룄r!& \y}5m4Ea~VmiQ_f~Vk9k6/\L gl"PCw$zlRF!iz2d+7x.Xܦp3v?&ʍx%*@b u,fT$68ў D!+4p"H33Hk{ ˁԈ@z&}(?.Nl@23\3>nX}`?w5;o>aղ}!6nǙ1X~\:mDscNckP.DDE4vDc3!ٮ!Ȯ6 mds8_5w9?SwaޢU 4LP?u=myc1<; ?[^jahz%9BlTO]q(4A&V1t?q{p~<@KkP1:['H#+}͇qݧvt"_~ ¸ubxu?w|ZMgDI{.dn|'H 6~s.lWl: hIe%|B` PRNKĉQ n*ߕh $i'+u?^><0q/ulf]\V[GBU+$km}fqb~2' g*opNo;Z)@4'!,XȌt`tU}NpYsE>v=J,x֧ы&yD1w4Y3ʲ1OR:X{Qմ*t c4KY>v?6WB|^@|"bbBJw0Z}FbєFKWì}PHmN7JA<+]ʰ0A>A8DrΨ`_fYJ_6{+/aGMW}>)JWB8~iP%ޮKg`Ά Ajg F'.e*ٵW, _,~{)뤥Jɪ\b?*K,N봃aKk:1P&Ҭܲ&<_B`0 4+0qS͵OBeqUP+ ;n>"WE$Q2=+|38&_aiL6'PFyP.|*b3c`.ð]hi݃ kH2蒚%V(nFF`#,D2R``4Ɩ5CL  vm*р( 0*.`Rč&q}g-Ql@ endstream endobj 173 0 obj <> stream xYMo6/AG;3 0 hݢE$Is_;]QAlg]ӇO|z?w>xMbXv?,2la=% ǯ5PC-k ^AkrWPJw}9Ppr0JW. w9R&cu 5RImG ZCiK&pĴr˜Xѣ- x Y8daU%Ok! LA/@6ëvS^Wn/OO_>jxfL?QXn0$?Q{~ m-B^8Wڜ$^~" ^X>(hD?*G 9bݠrE C{Y@]Y^ %ByPս6{;AL=X #:I ߞJSICM??Wyy UqPOJil+yXGTME,DhFUB.y I²3YgtQzhxZq.nw!LHi[0* ׁKT٬i1v4D&ɂN)^س;| * wKU},C>쐭i:.ng35x;0/gUX[%cdlOU06YEgdgHv{Cw3>[eq7D'뱭Neq"MYJ [\[9k9=>,MDX!z1gMrcX4Nc"\L$cccSF3A ȝ ژ5'FણTfh4٠T%vd0+K)gxv^cwR<¶cŒ/_'j$gո1TR|z_^JV2X:j˱-dGNf=h`Rd|_W _b%rޘ9g:ZS HϸHƝN sM?`fO۹DGLt& %37P/fn^K&4Pa34̈́[Xg s1 ӣu/G75`oT[qS| '#zOġdlcmclPW7$ԇ/syaUk}f3!l=86{i]h E:E ?YT4DHƅwpbMՐ/EmCCeڒktn_&=mqO#> MhI|#I+\$gVRgi;lTI?o"aM/žr*]|s݌$L#Y̼xɛ>S["w վmR&xy0eɻl th()e}61 !yn m2K &#T2T&!$ A:Ƨ1DŚ=sPk'F?ջ _H'(RB ? K&ۂJ1 ͥ6CY.jn^pj˙>BPgyFs݃L:唗6>4^Mۛ endstream endobj 174 0 obj <> endobj 175 0 obj <> endobj 176 0 obj <> stream x\K$9@)L/H3ԲbEmuOj)߯33IO.?|??￾<_~뷯k/͇p?A?pQT^'.x@찵_+e:Zv)Vҽ/40\Mh*}|OA<q=2SYFm;Ӣ5s4L+WvAe$*P^J_޿?_ӺV"*;4ݥ[{yP`o+ EeZܢ|qG?Е7 I RDQIprQ˿iTQ T^F4SffXXMk||bX[^ } vuWZV TU**߰$,I.T/ϖP TɿhKxM>^mckF &,8ƚQX^kw Z*[!Q`vmGZh hj 8jw" pj1Vmy,cC#yH)v}GRlpGDPH=|~gdKIlMꨶhrsbVmL8S P݆W7UEz[WfqEQ7-*O3 slv5nޘOd^+'Bx~||pdEbEP7SF( )L4egsJI$NVH1~1U[֊Q_'K )INiUY/F7gcuTU.rt-h+lQq%")K @q (O_=x1IUn RHB@֊G0z٢~ hMeҎiQb+%&6}@0269'umC5ϰN؍}A{ۗ P5<){J_+) LDD\BhFjp$R: @!#}Ә kkqU:X v(NTӯ:rLt9ćF_I2%ŁvP$"IK[\rp"9Z~ԲC앥BQfxAhYC9RlX SBLAn2ˑIӴUÇș7#sv$3Q;ƒU^XІ|m=rh  8t}@А'022'szJz;EŠce:?q}@zĿklW 2g6)G=yK2&.QxaK3bCd`P/@Vx+T1.Zr^PM?dD =xh!e/7Ze/)QrvЮ +{=UaAX( _ުbkڀAښ8gߊȺCڊҝu.hKݐe]/JRubK/B:bgbs@.,B'{ 큽O-<3WYE\\udCl ,5;HԤnh`d[11+KIv-ְMmE3%%s"$7dh$gC/1;rAF IM?83fB"ұXdbh[6f֘D-0bxU=x0Ec$aC_n"TaO o{lr#/! X8&Sq3'XKtn*k6 BwHp7:j?ldm8,l`e1}PRIR^=Aiz&bRfP oaPŀp?d=Bb]+9Lsi)Vw;(LbT)ʊP/ˬ) xn~$[g't_J2Kذ"ŷ%TNb!Tփ N(@]_.רV[x+z)[<գ_w,QH q*m^3[ֶ-ZW~GP6pm.:V3({@9#U(cm(D~d,9:V)a+wj/ܛmT X{[o~ Zv8;@GVTRgcu_wtH.Ilhxuv+(CpJG?߮K*0Ks_?}q=ɉ rih:>d$j|(\"3; u.(L+KAJ)2$e.V/MM&m~fMǷ@J*^@O)Bu#m ⇒Br9wrClgZQpKr qJ;gH ӥbKsn!@.ԜxL?\Ry+"Y(c޴h,e*-6-@+uŦ榈Vmg %9'`b!Lpd⭳Ukjs/gGv"`J܃* (ȡ:b*rp1TZUp 7h\l1˔aX MX\>X0%"^Y"kț ,S0˲M*H WFy4&qVaƆePtqEtDih# .TH3Yb.-)lԣA(N~(e*̺%2Nx}F;|:F!eeM6+ I"Q gffj! VdlsW`QiL Soqn6(tzVnĒν^"NACӍpw.=w9NBiT(@@xd(uUNB%=(J9I%"iJ Ut p34Հt=!pѶ-;W+NaG6{==S>6SB1Xg+RH9آ(xu[{Nhۯ4 '&:hsHy̐A-nd6&fß[͙qsQlaU繵Bp.6J)hsP>RVi i\uTAe9g%MVmk902Z,9w3&N:Ym7#JP)of@>_Kc t*["4ϼOa/YZ8yԷ=7+? G'jO>˅|Ʉ[ \0K*|+"ZF 0)0 y!IwrMO, ԡiaiu57`/X=i%Ş< K'M$\<Pp6>Rv' (J> stream x][ dq~ۣt`XkH&a٬?x6 !>U9ݘΩVTR>_~˯ߧ?oï;]|BD8#y:Sr׏/;f;)W*qrwBHn7t!?ʱ#;ę7ߊO Qm"3!Rm|&/1 ]E *qB2Qn[tF@Hό#gDNg?xI*qb:KG|NN 믿a,oU+hYNod_'"vInۉb,v|ǖ >ۙ yV[" wc䙉 Ml`<5 Wܛ%}\6&6FoQf$t$MVB3e)6 HUbmz1ʣT[U 5A_բQ {IFg_HM< 6֡H#ƷY* 'kXݞHWj}bw=ѣ;guvN|K>qim_o ,zπRM'΀"=rHJM}tA mL؁ԋwjqA.L~фl2+#iVۑē=C$t"7n/5g1?^1QR0t5M_0I f%=WGBx0|Enf;bxb"q:BvbD&txԗA^G!_K:4Muu4IPЂoZB1 Yx8ZzSxkB3g3]Z1x뚺M3/<2GuਗB!WJeÄB\3$փ vh'df?d>DMri6=?)ӎ_h+ҡϯDLuTz< fAoZ%"lxGK\#7D `CJT[QZ1:7fڌ /FL tzޘxP.Ŀ;8/):%6nNC|;m6oZajސӏ83'{=NI7Ϩ]{tu0({>s)ڔyiSB6aQxIxEhA W[Ycfrj7D{vEOĉ=uЭmҗ2-YvFt!SBÚ~z?tb;3vBfkdiWg)RM0f<|7fU &]"mX 10KLS] k0W=30H1`)cP26ñHZ{||SI{'.ʘVe1u$[ozʐi?aOkg<8WL^@>l򬟁=]E& k*C'ꭀ6M6O돺WBe&k)}df'VE5JBٸlP(uAj3TCXl&:ʀ0 S}vmkcFCi,O\!o8X{$gz gFIYABMf.F,!βi?9k d d-aۥ]^ T Y^ɴ…E1~lNѓ>%%h pk\[HOJ솵7ߘ;VF#TNشh~,>^aWޤ :^6zf7VMҤ5ueXԬ :8\%j8D+QBfI3XJfdja'[N;nqUp&=BS4mԌDJs.BGj7Ɗ|}gD#A8|igIޅsYz3dD5o`,{L(A ,e,W؎NhB{Ur{^zԎ$@A]V@gO2e;RoY6db{K%qfc82KP v޲J֡mb/tVh[JNa[9zK?Ґ=R3lƷϙǔ( ǔc2e0V&q2̜U N~BCM4L̉5g*s \Gp:+o.\`a6$i1'2dON^ɥ``m#St@P:b*ׄ ]y}DQ0i!$DM`z@@e8k[,*-0Q`>:B^ypM"Έˆ:+ 6gj¸ϒ pZqֆ{x3~(o{17F"BV{J{Ʃ6cdƴ `ď+(N1BP=ۺЌ*7 ٰL'n~&MPP!8 64NBrY3g pq 6$3G8V]Gf*I FJM^0ȃRNt$I)d3jɪ՛!wQƵd̆&0b9Kox/?J{0lp!϶Wa3R"NF).Yo {6\ ; I"9l! `縑p0%"V<[PԷݚ(P;$ЩN@$:ЯBI4q{jG^h|yѫ Q8(@$En{Bt2&DV 0bXJәY +&(xz]C-Yn^R&@MNXp1i[Àw34 -BȍZ3/4E_C˘z戦"h "7(wAaE Y_qF+NS.=!@]s,Muܣ-ׇLtdx}WTtUަ/+aqEGW)ؕ\?#s~MWVXYcRE#P S\pcIGͫxtywpf pp]W܄;en-:Up̀Sul-3O}2{0{2\ɠ:OPҁq6'(*WxwN! d8\==MPj$9Vk{;+m}$l6:RQz'/"Ps!66[9D.JP!82R ") 3>G6Ώ@Q;(Ajgx &@Kq2 &~p]S e?S0k*Z*X?Un+<"@lL p%9L㔙12,i`-(NU$&Y Lp/e)Ώn~8AA35ח; VqU=a T[naɈ=om3i.D)NË⍾Mb%b7t ml ka*KuE >q,|7ÜaL*sBHMrW6LqlnOgvA~Afvv/H`~IY_f"; 2NM+27XC1.5H8\tPS=*o$YQȦB%j׺!0:~6.)A7Glj6x1I:0r2}+k`"@[VchڪK:C7tQ:}ҬS EYGI"{(Xt6l틍[OMH0BHc&!!*M"&1(RiĒ݅oL|n{I^i9K* +DH{qmTgl!di?7nFoL*R`-9i4PU[W7\4VF)sTjꀇXfƪÉvcmOX[x2&Jq*Ѿ%\SʚU-Vf `&3+sVF\̘}ltE[Ad̪V_ދzgO3]ItJ_Yo0JDm Z|*BU>0^rDilbzt=>k/˞(߾5^!.T`&ݷv޹ߛjUK(DAa9!Hڮ+ )oc`1c {0∔G \7FH#!M !.rztg.ʹ_1"RJZ|#{Ʋ."Ou7 }fiPA%-lc^5̗i1&7ڹЗD jEY2A=`uQ_\_ll -M0~)+AQ KEcڏ 5)`jC1 6N0ɰQ;M `@ڸkZHE]) eQH˼ZroX?WnTm)D Q8HVƊ+~BT2WyuM"`?ưHJ<=І2.W3 dx m)-洞ق#ąWz뵑'zroG&K){6"iэݴy4b#誸]jF\F-Tݗ6㡘kL\i{k*4ff'n"+yT,-J┘w#ZRcތ`- % NaćSjb^nUy6ϧ^9DNiTOi Bȕ>kGmiZپhY O20ٓanӛڊv;naDGSfmI nc53Yw,6GE=h+EgFI/bd/%Exm3Zւ;FG&O:M@M5 塩SR;4wR^U N(0?^$gMYO  p<!hv追n=Zao$e@!WW i%}v^XHT[HE{xAp)+f_E{Z#;@0V9;3,ew83^,{b g&bv?ˉBlhgl^fPk%%lУkVu%=l{5~?b:HWyS| te]![A Z^ͼFbة5vH%8$׉4OiP3NK4t:w,NpZjgV 8 W-eG]˰.5iP2|h(I\pڬ%e- 8Y3%]cm pV6&8H9L㔙1`-(NUĪ3e1n} O+nCql~ko9*̶;xދY 0[ʞ؅v>$Ml .O(áo!fQ%!UV:Q-2^S"!.f 󾠗x/AHDF֮,C^(AŤglxtQ0NJH_'!n up'WÝܡ5"_m6{M}j2A [ךE< h"VNEK1l,?PC>:VqI]Wa,==*R#*ɥn5*tc*Rz:FM;>%hz@8^a8 ΢O+I LON]e~J$F4'/!?gƌT0د7xNP=?@nBa` ̄] ˡdh f)n)u[ 9?1fA%HmkTvࢻ endstream endobj 178 0 obj <> stream xZ[kF~7?]}cuBaÐMyH& e~Rtt8auwݾ揷[Լ}??^O|_?ח}{wT)W+_j_TgŶ'&zsniIYSo"wA);]&qz#Ɩ>>A=_\gUM; UoXW&έ U~|PNPhkU`]+]ݿ~gm+\ŁXOK~jGW=.([=s^@jōMiGikRzFTGu_Y<%j* upG*@o/Ou+KhV魩WV!\rw$2޲PVd0{/P&A3Dz k]y_a) lRM~{A8yׄgG ݴ梧f|N}mVaYq8}Yt6Wye>g#TϹ9J|޿(m]e[t~ya†EGu^j<9&UZhICE _lGq4q{9 {$K%M~%BV,?<##w.4D).kma h#2#x|0iJ\X`jCܲ$asB~zv0e+. ȸ` ⢀SlBN} ŊKrd ;iqZDǩ稜YbE;bq]9Noq8-硔bюQ YI|䇡)W̬ 9.b8e_>gEh Aq;= ]qYߩk_]Wj08tБ/Ag{ |IUcF%v%jM6fbnt2iY/GŕFHRf*[h-ª# j8lN>T=f[zݮ;2Z.fl16A :7hAg\tmuc({ qTc'V{"򁕬oё ]dXBFdplb_qɝnA`6>+gU =+êM@CsU=UxZ#z}V6DQ"@eXM(lѼi;NoA$ )e=ΦKƼ) E .:5R1jh8HRYQ7:p誻fz#ISk֛ WzכȘM+䱽%9z<.7>[x+ξ C EkGə 1M 'dM%@1CjhYˇko?P|Z)_xźT[MribH-F'4(ql^4Zy H.Fo1~նkC?^cJ_*n+@\/dx\%- $26.\'Ǡ M5 ]1XGQpid%-ZA3\ޟ)MنI4C C搯a^QBwcUt)]j:D+%jkg*,87'gèH襨Q~ZMs@wڰM %RFz{eVz2b'Hg렵[DC'Zyuj:$xdR` ]DXd_RP<'BkT*tRMRPjoԍ8+ X+j]0,zkQHV(R^v+&eӀOCi$2k7 ~'hp-fՌO})XhLN+e-DJ6ǃuߪ:aپ2Xe)A'' ̒g @l |LMXti۱+9V%10QYJ$]FrmMcGt]6Q$3eLgq: h3Ú6h@WHG l RKjt,jL57@LQ?m\3׋I>O{&MAuIA78=yXTK8co0R?{(QKeAŀ5!I Xz Jv)me堙4!S sX:I5DE8u0YR34t7eRs?G endstream endobj 179 0 obj <> stream x[M$7r0. 4O{ ,A@:+ `E$,A"x"矾߾׿ӗן_ çn姏݌ Tc>~P?ʺ,95kLg@l Wro?Xj^N7mE^_{Md[Rh7SjC "u]̙x_ vۈɛjTJśKn/x5htSM>~OӃ ~׿*5Z3/?|BN %#O߱h8T^떐k,H)4mѱq23iHR\ՙ;`a|-6mVPE?v*PNnZ7I~0:KCזV>fxЫ v7}GDjiYOȮ>wE ۅ+~IqXlPW#7Xx4p;H?\(3n0Ԅzwߍ/Jd8084]/n$׫ǽ èڮ/LЃjMT.sd[dU<:@Wt;EK<i0N*%@VŁIϠ(2W78-HPP7%Vsφi0dFA o=>.Q"29LZj=j8D.&E(J-X~Ԧ *tnV v5_g냊^0-z[#b8@6ا{ nW QwCxAR#y+̩BՔo/ wwƙOBN кYŐYPY'Jَu+q>1nB>6: [7-+k/5H { U`ײHƎSzYT/裭(A;6&S]OU2,^~a}}FȖjMwkJp; &bgEhWKrptlQ8-=2vEk8 Τhc.ͬeZ Ź dWc-n-Ӽe(@&z54xFTlK빪,v0[vD׻`ku3ְ(? p(YVwTI6$g.J `+w[0D&Y~f@hM. ?B2 *dy@q1P T '-YMZ9Vm*-0*&(3CgFk4As3wo?_YY Vĕ}&FnZM )I XزQi`ty|W&I B+d9}V`$ t BYP(Ws:xqgGZp5"W^IJU(tģb` B¤1e a$|&3 /)1ZHp8wiWN{G}B,Sz&Z?3r>S 3Je\4p(v1i:]Glnj᢬j6vSZXxZ}jaa Q`i0 X:d#7NkoPgWk. fY W# Dh.,` 023j~bPŸma!C {'lCtElWs]s4bx/TN%P[~{W%p+X%oLe|֌%݈~hζ%6"/j'blc<\hCkq=ŦNQJ{wK{ƕwRO?`5p'%^;*JMj`U""<e؀r !5˞jOЦ]Dgp2,夊+vd x4P^F12i1 Өʙv?- Z`w#2#6 f/~؏%1Ip Z| Q,t(~/G֙NAnڮ?4Dej=?]w> 5$[4 ;Ơ"?s)qr|n^I2A'*8QCb'"oYIv/ST &߾$`#{_u'5ddfRJ.LB xu8w?6 F$ގy[E*4k00 F<%K| oa o`@0R: b=yMڍ" B;8O@PS*#{[#90g<@Ӫue- @Z6[XQMįSPTCm ~z-ο^# bh{i74IM\g`<N;G= #n'S[ B2'3n8W>Ct4IцnJD+P ڨ08J/qO x.(sRCJ`)׹%L]jɈy (2"Ԋ^=e85A#Ƙ,sZ@WX t,Is&·"*qf2hj"-Yiọ!|$Q/0;s߹u]<ڜg]Vt %[LR}oM)a3xZWC)4QC1w~띰x]r.TnC^|!>ЫXäy؅Kb(uϔ;Zt^ssZ.96ԚotUG{  Ξ _9<߶,Ja^T#雞ɷ[9t\z}gA4 Y\<fby&M hnE@2'dr-v#fr+ľ !xS }iuL@kQ׾53ͤwK pt#T7삥ɷr|PY"RrjԚ]UG[1B~ks?{[>q0*ón̍8NdwǺf_d endstream endobj 180 0 obj <> stream x][Gr?7[Q qِ%^V!:Xym!>U}!^IoMWuuuT?Ӈϟ?ߧ{~O?|O~{ܮǷo?ɞ>z"ĹZ>iKN 97 BިM\?s/\(Fo܊!D+93N;NjrNWBudԢM*΂X}⦨Irg0E ,J冝6>yGb!$\;N)8OʅQ'abOd^x/oߜ7Ͽ7bfbI-4u/f{bWgwhڟH7Z8iiX }^BMK<;P/fwKֈق۸lC/B+r&2WIKP; ؋?}?Ñk?~[1;ypx8q'ʱ#LG9qІ0+,Q0T[Kրiτ\,g!4܇8C("9%Cȃ]!z$EgHTw~(b/Έq"zFDbj߱z.]ތ&no|&U݃.bχ^aAyX{uLrJ4./W Eyʘk q]/RPCR31BCdW~%n {@zlfl?n7iq:'QY沤if |c`FpML2Ms(Ψ1<z儀9'g:C2zQf`T:}r>j rw6F\*7RrՊ1 "!hZy9rWKqHQL`h5p9C77W[Ip:[4:ԏ6-Jk'aRqvŅwx&#61$Gb;{Y%n@$ \9kV yj Bg+Ao#f {q T9Y 3+8Nrwkpsf:5.xT)X=R c%P:~gxЮ9DU +fWt 회+ U 8۱wDERu{AaqP6/lx@a6o$ymj#XUk"Z͘K-1XMREwK{L\UA1mj&RȄ Džbfb+cD2Cw{#x~Лtłbb1G2Zw#aq8/bv,y!Db` i b*Nof\ovmfFҠ$[,U Û%u6U|; vIR_7y@4ϛ.<3贼qQ=9ݭD^ku-@Ο1'%j^bj0c`,B P" țLX?8jޜHh]0Ό~ƞTijhl…@+,[`M6ȅOE֕dNnJscGPd\(3OU#fR$`n@]@Zuf]Hp(9}R˱{}=!gCԓ?Xxkd:D H)@ \E6^idLqt㹌M;k)瘗sl/cG-ikK{0…#9]55)FsS%щZPdv$-SW *fRlhª~fylt`a0*-ov&L+׼b e:=! Z&SVҘ$-/ he vO?^~?ZikVxZw _ MdOG%>h>?ca$7?YßS-ejg4JkyP\2cTP/wa#uhU(>2MV{|wlr; Hй,jOoycV`T sV&"Fb%P:څ^b;ͤZRl;Dߵ'N{>O-u!@~S~<| 8 z)]YP}.{dӓ)c`; N"6U@U(v̺#}؞ Aj$T%r5oJs.lR :J<%{ؾ7` XaE׬]afsLOAB{KyĈ84@5}~ڀ kYP EUВ61Yf5SSOkCܞ[n%Ne ϋK 15{ޚ۟s\N7w=%pCT(W >ʅhjbאBɢܮWŶ=_rmhuaݱ/L&av3T &JNd5]{rOV 5'XM&}l)RBJVV;2ҀnSn@V۶Vڜ(Wv9@;zД=)[0AʦLI`TS5VVږI9y%hsm+XDy-5hY&ɯ$вBIhӲHW+ 䍔^6oneyLHxI˦-l֑DHFXI{䎙'g))Ou5 E!I{ǕC6 a<",/sacw"fJ3dҝBG+;鸾iyu<Гt7ĀtTh#Nd-]{6Ȝ 7TK XK)?>{)FRS )} [ʍ$^Y)7z2૝1eZ3m(Py1k-P1zn .A|*\R0x:hʞ-`<<:#7m.nAtt|I0b%ҮݦIEyHܼttPFidHiY6 @et:2wP(\Bͣp<Ai(V;lw.X0@YӼO`5(ںVޤZy֩#xU*DT}km<}_5wj*E5̿>#gcxѢ.U}AƌvepUE36O2.j0]nrnhz7#pUSgPN3ntډԥkoiQ/է..uRoʏ=m¦@*|giӕ_!pts% v\L=N'\\Wml?т>{rqМF-҈ rѣpֆ]E=P##$#?"#ӖE2rpdҼI\n&6_"=oҐi" uaꡤVˆ4cPv&j|*)<9UcI=5@_bN T6Bѥ=ZaPZB됲 (S* 1RQڙ(݋Cѩ{VZ9וR!`N3;Dڵgظ5ŭ^j[M)7 7@d:%L%j7IDNށZ%v6I>.,~I_tυUݼnGW;(^mDN\{^(ǃm%=jGn:(ԏaXi^4VSB*3Xzą+__{i|S5nd. vwjv&0=`8mV*{U*^݇bꙸ@ .+ǿqNQ3FSw&?e4^5$}Ef kT7sU%{QZ~yT7aDRLUTSmmĀCwT/tډkφ'Nl:^jM[b;g'z 93/T ;7TP&?t=wBO`\Ьu :}]Ɍ;Ŀ:_V{C{mJkucۋ31>%E/n1?xہm{u~efv(yaؐ#'5ݻ<1FOmHV~nM,#/6,1}/kdsu8k(qLDjGŽ s~]͕ӃØh-_79ֵ| !6'rbА[qw?ʭX=J'R^GMPT;}Mch6%Q}F#=j5>c~\_/E:k죷8ul~ta |_)?^yU8BtŞPmyZpYQwOLC;ʃЎ?fWz U|}[獑X?[K9tJ{O^ks5g~龾>K?.C/}ˤ[[wUQuzx>>Pd(]⏶ ~QVҥB=gbeW7Jo!AqIʄ/+4*A_56c;fPۓJvNE3Hu+kKfW4Mt[ -|LSzJSt+SKlkx),U8`1x"֟.'w0ZV炽,] sA\=W۫ eWfY;Anܽ]q 7̙nWxb| _DhT- յҲau#յZinvmUoG&~_. o} յ1}_Y]m,ȍ3'gjcrKWsJcJ:4ZrM˴EPpi LZ&_j>O2%u* /ю)v*uwk^劳uE7&) 3Z2gl G"JE+_n/$LItrDA זz9H)7Z;gV@! }8W6ch($)ZWOh+ZBD{"bUt8qU[U&h|ׯL^*D`qn驛r9Q endstream endobj 181 0 obj <> stream x]K%q 8a { Y^xa6ɿd"HA{|OuUXd},v{|{?|߷o}y?|~_ߞ/珟_?ވ?z\݉iK>g߼'B>?bRbBz|E*BMZyfv_'ݴQ7a]g8z%k!$n +6ì:(z(x{_q#Q<q<̍ޝ1+FnM5?G]Qss&Fܨ+?s@E>֥4j(W(ȶnhwcc-.){__~%ˣ?gѸAv+q,TD?S 5[VJNF:YI4F '\J:ػvOJ~AE]ؚNHnϨ@˝O\!yEOnT"^>85a/'+>DaT >%, 짵ˮPWFI8#;B ˀ;({w܅ Wcg85옧3w%>TL軑sL;\%BhKJ Y"!%mId]X[ӻP(#!P&SI`LMMѡkRÀP>Bh)'arUHQŐZ\ YlVzU5B EWk|,@|*$ ͩJ֯>}'rz1HA~1}|jmPuRUmg9퇇~o?~?}5TjKfO*|(U8ʎ~;a_~%%t==4v H j\B_]w;r+ûY& M8G0ۗxcBV^ƛZiBZr>qcQ4RXw=V%~KJ7KznqQOЇx%i/YO=qUO:n)<m%}V1%%rFQ jX٠X]"}v%5E+VLUV,`Oox~ZHA*s&שּׁD~5~\4^ %[ bũ`(<8:8JJAL! S9 $X` ~[E[7q@FZ>݈q߬d⅐'Bٳx+jʃ;%-\ltoxTPMGj)!3ԺJx){]8jy #P[{c'4Da> ? PP&:a35$iܞǟͦ/)T]|+)pqqIJ]ϱ+Ŕ<Rpu&¥_)p5H h jJ u֕[7W237snX`y nHbMb*w: )l'IN:je%!xDX{3Fq_Qk9ʇ:lA3(B hU pnp2닱$(DhI+A-@%YS;C-78]ncna5T!Fjw*x}{Oݳg&I%zfvRNj}J(R!UB~YEOyVYUA^ vA$ȑ̠`]bn^sŽy5#=:G$g-xUe7Ď{?6爵-|ʛbIl9S7{3ẘL4~T&T.EM.O4?? kyg}5\,ǒOzݐ:q_NE-N+P-WnWWF~^㧿kؑ3)HВC{DVVf["H1(v*3N%xac1 ֞5\ p1oỊZ[3Ob`a)J*Pڇ5GO&P=\@/kX+tP62l JOew+vMྵ vm "5 h }O)yn1:#6LE]?W=L^8)>ujꐩZ[,310][B-r~ -A[Πޱ %OU̴5p/_3=tPX]nvk_Vб LCr+<y'2(5 4>@L9jgWFWKt` SНRv]0Hf `4  cHB:dGyzK=묟4K>tJl'}k>;&~n1 Ã4\ i0=(;]S"lort#׵ݥ` i&`ÿW'U;EU.Uiy‘ !ɽO#-r.!nUCpTzFz~lbW>_-xijʹcճrth=U)58"{7S5vP}Ѯ'jr>atSU C3vv`;V-?0S핣[ԍ>jԑ3OBtgcڦL~^בzp9?'w[^#VYSAΜErST3ڙ/Tm~>{ƛP\0Z[*~q}V@^2M96@1}tjϝ1{o-fbp0y|E|E&\Pp݂5%X-]J۴oJ@bz]Dɫ}Eq9Q5܉P֬XښB7%I;8ܟR@o_Rq4ԝP`.]sژ6%fLvJ[W쿍H/CPL59~|9{|B<O @;o16Kl[ {Ϭt* LYT>1X|!g Йb̃K" ½Ƭ/R_uZ^`&kɝL5'xX/E"ĪGb'h. tҷҕS.Fѩ@@61]%6:tLѩCqs aUlf:aT[s#2] ЩPޣ:ǕmBbmSr`\5`O|r@5X*jGJv'U\xVBttc4W } J˪BrW:zM 5t5-0dgsV PrGu9uf΁h5Vӂ:f`:ہxu͐MړHg_hk :nB9%Rb!:(2)`:.(pV0DAF*i脀Ü\1'Vw>4`\,-T(*/(M,EAv2axr5E :tB :Nt[y򺠛{'`QН :xroɱ}5t:o߹=ȗVA{9^וP,_3ZoX~_Wv՛op\&wW 뻹cUvbhct3w/'}א{0h1\-oܟSאyBe]M k>ӕXe/ =Nmɻwk\Zz6+Hs9!n&Is91 A3W&IBz1PqVb *,%3c1+qmh q'ja;43W-el-!ھ'ۓD'tF(12(+ҁ5:P嗶Rxo3Qs\{*9':{y~9FA_8ҏZ=z_E{?H|F yo?~?}YqWc':3r$O -j9E\tNgYm;Tv+k;4q U8 @s{C`xZ•d 滛0we}H"0Z/,"P%7-E/s{1s"4o?RAYKw2kp.NJ(cN7^#D+y`aXM5Q>&9A;E" =Mw<-?u5y _ 1\н̮NVjM>JHgs} c `3@b2:9 jLWLN3j*0҄Ẻ:kTXV938QNGЄCjvL2d5ah~ ^f&l=ҵ8(tV~v)ѧGO~[[?$Ia 9ǹ4dɳ6Mk?O<&/>tA/z/VK}~N+}+{YN8IcRSJYb%c/&r8p"˲p ـ.*-ѵlgQ Q_* @7*MQZDoPv-pW"NYMa〻EQNLlA0 &QnA3dl+@:0+|& `tkDALv'ڱ˟oI=JQ.Ӝ%2*F;9?]\ p)Q_zX=ۄ?B}+ }B4p,B0_njF>#6xK |1`\C~)1 OR7 7~5* C@Z6h4-|P @K-yXs%qBT@u ZНg-8 !2]59ApwW&|.z" Zw &UKCk9hr V-]-XtT&P]# _ۥma+|//-%lc)CM̆ͬaf21, =Ű=c+SW !jkѸV #+p)TQwHk_˩-hk~/FGt[9-S#6ʉr{ ;).8DͼR|Pp~Rðw\C",mw VA1Ǜ|1&ŰCU&=V_b={ EؓG7uoEJzD\jr@0"Si2uS`9V͆ ,Ρ~Wݐ<6 D瞖R/w ٷ\~-la  a؋'&` xOPU `\)}P[k2K`8#@bd-X.MfqŹ`*'UQ xDs!s`#Ѐ,,l7/4hj@a'>2 68]Fs!JQiGu$aP endstream endobj 182 0 obj <> stream x][%qp^ ;{F l2!gYZ%%ucΩVJԟo/᏿\||??_>w?/?_~.rwz^pD_%W._/?|JdO~IdOV< !>ȍpo?9QA \}V}C>oTUJ])x|&7T<5OIn3~S$7WJ.*c-1iUJ?~_']Qa^U?pyy`Ͽ_1&KzBl;ID]oFz]7/U_v[sW7^JG*s&J_ Y\<x9yB2xtEd@TWaᦆD%yJpeC~QT&@ VfrL^,n~^y1YAuҀ^=8Q>lKqs5;X%/~<60:`3b\5Epb{ F Qò]ϒ|w^y/I}uv==1' s՚=BHyt\˜GdgEn}=w}A&%]$U~kW<[qMdvsm$괅!H cN  8-(8B[K_%&硭X('MHjl~T%OD1W$ FQFܙyE3vT1(ŭL1˝.%9X ɌsRe 2ņk T5c (c$;e#L yiؚ쏏20_bk'd{H̶Eb=͘o#DO&l|MsώF~5&9PzFЕ'(D=j>oB=nҀW#5$'"K=wBshF/{le47b%Q d4#9 $ml0J\Us\ %alAHiY2H$vF)"*M%L{89!rgg1.G\Z inU>Ы$7-h 5W ->Zޟآʍw~|+~K\21A^cqgdxM?*>jFTٌo]0OfJ{%5&kwhwk5֬Q95EASX;KGi%OkzdOuB ]M2*"YV"E yōCIHJ4."pA{ݮ|8/X<8W4AFnUuvAwXr.nJ Tl"/x|P ZWHr)|r$y4!Jy&~=wo~'Oc^|Q388;~x[<&!єQK pk"?نJ%|N-knWT6*QJZ1SjjYXtƝ^c8C8c3i۸`|:=V ;r?⑦^`ǘ p)v9t _7brY>s 1{X ]KQ,uPuM R1A2^I 5qr2Q.Q?|߿"z`AM cwPo{ҚA(4i(ZךCVKmOwEɪI5U-ǦP+lgpA|F@qtϪ*႘'ZY; >c=qU5DOv?5X=*@<8%#缾5ރbDCNх"{0LŜ]j9aS]KnZVh ;dj 75kI\X%.D&.aF;vMHm 74VMw f5J;WUڻ&{{Eym_Fy kS `0|;_IӄQQ)i`LP>ރn{BmoC]p>Bៗte+h p>H|*u.\*_XnF}T4ԙTۍ 8 AHqþENelU'B%j$HGMue)Dx}.f|ζF/e_y)#7qÈk5yE>ɩhi@(1̲:"MZFG$ ĺmvpLެPtH`a?!Q/./kOo%'vC:9_網I|y+`HO/ N~jx;^ }a?P GtI =pNxN>y4.|ExSr"+r(5CRb[{YjF{ڭ?tm?gTg|R9qha|d?n0 {sޱ{л|':BUo[yN˔}ŷ|FGzv[ꑷt2|јH54 d 0P$P$H$e#4 I:OKjF6ɾ((TE !%MHӻJ*j6 kDRQ{$B[) E/vTΈ`wY1hSgb;sYn>`5ci?2 "/5d/V+GX`vB CR C,ZqP_5XyExaCuq3G$~p}~WQ^.3+K1$}Y`˕/ݫca"pFo<#rsd })Uw`9|˻VD`fn־"ַ|yIYNbͶIS|ϛמ3sX.fj.%aĶ54kh F(F2͌2#3nެE8^,UqQ37z3ҩZ~%@͇K (bY| #u-WZaFy\@Q  6 BԕiU vhaS U,}vʼ3J6xpH; <,pOHV4XjbV$ "0U/ĺ#rasR,k0K nvc苨ppt 8_So"ABw.ƁzM_'4IfY޾ˎ^Z oo0h:]n'Dj Xt]rӥz_=VG-ảQArXUо+12L&h皲wwfR wrb#l8lq =pa{MVOlP(Vi߰nl&=TpHQl:$REvB>\,/=i#'\_{ԃps3m+b1+&S>TpSΞ N=&`oETxI{ $J,jd r᲋O rT~w?\ c(W@o,@ 7`lAuXn,5J *!mTmeٻ!~[D=1I2#cBJ23& ]&(6| z( (+J̊RK"4 Q.U\Xr8)FCN;ifUJx[hDA/5F~lWFpkd $nD*9{k\x3\ N`.5|`/7 B{*+谘l̅BSOߚXߎol7,E;dD#,M\EtԊq1FU".0v` )qgE 1zE09?.d?3C7y&Zs`&}4Xf:N~;|i@? U~Gb:-늀O]ݑn@$ !A^l")Q߫ڣkI݃H {:߾D8D  P eH""ؤÐHv6Dk2xU)7*" H H&J9.BCh1! p]аәP=o%a!醍>D2$OS1@_r Y'6F\, Wro Փҧ2A$K*UIDD!K& ¨S,"" זH F5'T~x2gH+]j/ 09d8b>^n" :,&v` ")1gj<18i0q=j5bpҶ^$pR^!@P^K '2 Lr@< d6 s]8@W`EpoDSXI{.V~^63s@X(p hN9v6(Xj 0z0"PM \1z1tH5&;$90> ջdJ9Q V i3՝5komK o崼g į`A-{n>nBSqTꦱF9TB_trʩ8_܀EYϋ61+|6me𢖱n:/gdFx$3i*/5VLdwv˜=(mۉhF\+=7ko;"|m5DY Ԁ7,߰7ڭ%gY43a2{3{ӧ ̔֟5hThgZ;x䃟LWhP 4(Eh`&HD.ģM  m! Bm@E^/ןPp*6߮(8B%_ χJ;Уaj}@@5T-ENL;N#bEON*[0J?p-v@Kub Ȏ N~n | Sm !hl$tN-w pLZ3rmvNvyEqmPs;@_ r p/i.ؤ'6a~g]| (C(oTAeٻER6~1`U Q[(Of:u8*Xې I;Y'.Kӂ'װ4QWXJs6%& nQUKHZdl>j!ʢQUmqG34R{dku1dkLz p :ɵHt !Ttj^;k{ʔt&iP437b(, euLre{ *ivdՌOt̔w+;>3rVZFe m3빍 F*LͿ`$] 3uAm\Iwt!Dm#O.mXA%Pfܦjo9 U~C#.ˊAOMvL=;&_q I,9JK j/:esWJk@??\9rAgM,`3QPV ڨ9{7$*<(#8&)tn1tH5&;$MrBC CWG0&΄2٩ͨ%4K I?͘ϊnKmًwX4v\)˸}nU}+y<_Rθk 2 cf5dN SWlqIwoQ[H m6*6Km6˜!o8,sJ"TN.pٔ:,K{@35xgzE(RiP҈nu*h]ltHTJ[>%J> stream x][$q~_`ü5_3g1bF6ȃ?XH{!MWWGv?ׯ?~?vܾ}A/姷o腸 j!-Y8|73_߾NEK~NdwzVB}!Wf>o߼:QAۈB-\P{VeԢMWA¿+j\)fInJ.*| sV.]` aK4 h.ˆ^ȢO{Oo\^rpׯ_[χIcfAcI-I"/߿rc0Xo ?ݏ|x_PHUR-J\4 34r=SErKt#jz_QkPMz~<>S܄Zqz{\<5 ?Ud'0b˱vMۦTې fd c$Y.(+H$g&M,8osE=Y4`jk )!* ga֠L.5lW[I/T.CՏX#w~t:kK1{bO_ыӈ J*~Rj!"nz\%_cuGJJcZvlg&6ck S+J¬K׫u(QqP.B1)ՋVwK=ʶ͐4-tyuF`aD;.c3r뎧\@w<Ȉ;]&IPk%N놴%3˅e\/JvCVD a/I𝔂\&f gCZ|ieʀ@ŃV%h~- -4'Wbj̓B;j ^rFDI rn }j`IaAa@ \YR0nsNx8C{@]8%5D4X[hUĵu"qלP+޷O~l}F!}Gw#d0*aa>t!Z\&x-Hm#5W͌,)=Е[_*ط_*3(2͟=8J9y٣>{XV"ل_ں=;#;k[z xmjw-vm+{ ن^U kpʡ85PġECM$@od{h!=4y&شGVK42);qol4CEZx7Ƕu^$GkALjg>2l., ~ruh+.9v*Lw`@ trsm^ 0לn#aj sthFt vî|VJG?G -Klx$͢kDih# Z^Ef_x {ݹ`nɕu|7PS]ڐUhk^j[q`6Q99]&=7b+::/ƩMz:IvjZ%)VSa0ajp؝1#'@량`-8`0@lIdt H"{VNO|F ` Iň 6c$2V* tHdU^Adh3aX\Vml@@zm+#+ 삙j+ Q)YCA`sla݈ /FpKt6PlA`6txPA&MDJ %>PF smWvYŽR VrB4w$J!Q@`2JDNncI`YM8PiSW 8u ~pYF+bM5A[NZ"u'm9HБ=*XJ4IV/%z”JC6a%tՓh0ViJ$}a1CU?C[ JgUe|$UX90QIB17a)3TIM_\"WBM<ܵ;yH?kf}Z5ok2B~.Vh~+J ;`>c޵Ҥ`<aomqӹȮ-{[@-Y8f }V4 }rs}mnRЉ}\͙J9Vfkruuh̢P(ư+bKn,ړ~oϮRJIZm>w"nl\ ޥj]Y{&V]% ɮ/][ՔڮČ#)|?6LC#R0K=?2H?o~>W-{wnH+<>ڽm k-gdVK7I!rR6=_6f.y0%rO}3x z֭m-if7neP*Fi,|i= -e} ~d}c=0 (vu')!,F4(|4&U-7^g4J'?`ʗ(a/HIxA i`9V" Ɣ4N]3/Y] 3rp ~g.0V_=C "p&V ˕HT3 e qP6Y Y"Z.h"ef04jR C\fRޚV܇냹(釺7庤IA]5Ś> 'wOsMiA@ZC!P߰0DaauXynnY{Qz֮g ti/ኳ t3FL`nR3 g<Ҙ FWT_'kL'1݊EP>Ṕ6v!A%w{PA}Ŗ_gZelAeJT!l0c۸xY3\{?8VgreQgʌ^ \?M+z-ePVpT\m=f_fl=RTg T~M4khf v jN,8B߂o`#ݗPK}!mf _F_fTm1~b+`WB6L@ߑ7#Gk?>@e \ͺ[PF`b4g7qdkguk|ZJ}&kXc6=%gs|%hw˘H5w؍)t+mE%+eKKz\\+7yAG/vJ͜cW ñG݈6 #^xjzK+0en,MՔFz%#+WU_qo i=C91%M3HKF3>I `AgUd76>?0KsEI] }O}hs[_fwBJ8cֳ? g@2>jќ++?&jG|b17 pX+Aqէ1= endstream endobj 184 0 obj <> stream x][e~7?w]Z>aaL!vl aRK% !ݶwT*ݾOowvo}?o?~?~7ߜ._||o_~AO8WgO gN?OD+T+W-?s/\])J}f}ś5̱Ɯeiۯ؇W0ZB6OTr7WEUb3rK$7gjN+:ɡ1'yȳ`'#ؙӯ?|TgvFD:w_~/8qҀ`m9N8Kf4]/1AՉ Ǚ&?Y!n) 7,Д>%C;m.P"SuhUժib5'sDd3Nȝ~f>T\s=rSFΊRUc(?qZvU:roٝdBJX+S P"KPYY,:yP#6Q;kt5w ۜ>2,&IlfO!j !1M9(XFw ^ NƓ}i܌HV'mfiyy;VBhFWДp1 L{_فdNGf2N뢯I\ʲFGiBc$YbH;f'-nWv8NaH7''O6Nz]D'{j>$ˮK,okL:K]ď٦6L#)*M)V2&E.Y\Mm")nٝgc~&EiEƛ0?D7T7hӡۮW n*T7# ;Qef8q>n*C_YɞfwN"m 7}w?M.ČtC7%ēS5@;\HI*ieGSXR)N\,2R $R>(j9Ue߱;ix6lGKQ4B:_b/(7 DN3ap3"HٴVpR=Eh/NS8d]YƧ.3 0,̮- Q4TTtP-j,kqYiy'ɾ;Wg:fR:xRQ}Jsi&TC9:KuƷ:U̞I0 hLU)l鼂 i-$@U&"@BG0NUd-3u3U&VWyWNuz*)WEOWAbO;;p# N:bduv ?RXjלZ7UU@CMw%=p_.=Vڊp*4ksk ^Ɂzdzӂ;Ty@k`Eāb:܎8ٶ(m>Jv p-`GRpDf–O-p7 ubaZ]؀UUsШ"Ak ;Ҳ0CR^$L+= ձ!d|D@҅V(YD I\ :LMV7 /B!B!q!݅P,[ USH7eOb˳'cKgw=[%IV~ s?&ԯaS#N@dW5aau2Av~g@59/?ޢi~:$2\ߨաnkkO4?p d06#xp eHaxΝv8@zz#nld%l5}֑lJCayv`ʶW59 Le{ETvxjYurUvIJlQUtw9+ӈ նEwa0?m?kBLf @%,Dz"d*43p܍f͸ݍLC{۳;PyɷhHkM4JpG*F8;DhPQwleg ]'%|GŅ_vGG@; G[β:mykw'y,摻*flO`hYTgxQ4rT?~Өw8vT|pOSfܴڪ㩕mZ9ՎQi3дusO]mx 61`kxpAGK(2( L:heF<*1b<^_cBK5t7 ?jh}/is1!o!Pt0\DIE/-hŊ2>Kv{xQDڸׂV'aUalj|I DhmeMb{>9ɶHDxz :q3z0݅] 1J//C܌A\G<킕NYCIYދՔdb96 96!r@p)>z5!xA9uM]L3Cͫ 3ܳбamy~;|njh^ĂV:xXIဖv`.$1(3@/D@A,Z6҅Prt&ssyn*zr wǃ_e|ÉkC[% 6L$6Ĉ`~̋9} h?E9nhdDW`@_;1Bs#N֐5;;w:`^Sl׸nz]u0c F.&> '1ϩhݒHpLL~̆} dxzƅ_ϨI ?w'Y84c\g4;BE~}pȄ^7W U=Q ˄eB2L, PAe#GSC}HI% =㱐MTJ̏+,Z0>ѿM1'W$+c_H,ږR{9XHƙ7RH-SU3gE+3>P?j*P&dMrSo4Fj 4^"2i$yy#@# ߳DZ(eV1WyOdбIۆ Yf &hBkO 2@[!s5jb_D@7C A q!hT(F+.q|c7Bb D*4 &LAW$ yd˞3tAB3MM8b(~xܺڥR n.r} Þ]{\u8\lNE^3YJ鶍Ƒq8Yߚљ6v0Mܭ"sj +;Sԛ(I30= lbq_‰cp; ӿtaDtƷbȌ÷= ҭEP)">C"uk>D)?0=:feClʫ |z8+'Lgz3 23Z&sL@3|1?m N]%pCWf?t )1Mm6ug@Af;7fRU AkWUؚnNDo tL]ZF%&]9@`W^7 vl8*iU̧)mi[k:m ;}*cج/ orsV]܍!zD7(ۯ0P~åM.g:0;h.9 3u?/_}(;; <=lpxmFYh$:$jeď!|nz8njCGq#`vVwEfni|:@oI~HXH.{!6f3B> }.B^ BSoBZ!G!ݻ?Zyj|ڡ#|テ\Dh!7}!G-WuV9-v<=ow͢ļ<> 3ѠkI[xj};wqvFڿǃ9"#6@8O `8 4hJk|ȉj 6DIܱ\ռ~lG`_o|ڟsDjjN(0s  tkG~ g0/JKE& G*C`Waw k|*;p4=ok t"7P$2|>Vhӳ|=qyV-Qѿ` gt|J Lh 8Snz@KL -hYhAYh/CÍ %ܡtKC2Z @KTSh5!@˕H arIPJS\g!@˅.ZA2]a,#ll 2eiXb2HYBJ8 p;^,*eeZ!Xܝ!7e0syP,,YSO[28 5V ƊeXyj$#\x"b,XmI fW?_mCIVnoj}'{݊VfϿ2pB5=í+*ɋ~qB}4B7~o^W]jWV$pTKVGfY[8\lz5k[P")*qvJHu vৰ@rw3Hs@9FA˺huOS /r]G-e]'ʤCR'I7} n@1q$JE֔HRa;눾B;D\jg!eYy- tWôQV {TTޯF0AV-Hvbug endstream endobj 185 0 obj <> stream x][9~7?˂0N~c ;0z3=J2uɪ3|T*#BOB:ο?~?}>}O_}o>}:]wz?}CO'DI[2qv׷o߾9SA%,ZgNf:s+m̧>77*c:!e;^#/楔Q,YHYYQ3Krgg&ZvL;=Urd;7ӷ<)'vF=I&?޾9t=} kk ̂ŒNZoD_Q]x&GWoß?]u>&$au H"LجSC4] nɢ,2@8`;|SsRAFi0:UܠR;I.R&uPLxN+I2yx4/V־鼈H'PX_> |!F^ay4,20wO8Ï6 }FKh(; j|ϒkNwሆIC:ǟrrk6Ĉj46+DXJƆArNXjv@Jf$R**EʣګH"J&DVbdzXTlװ UR7ֈUxjC+ r:L`Ef-fK뚽.QQ3j͝]#6%)o2R.cnjNS&c@[ ע2(z0;i(xsHp2GO|ݤ.LVRX:PEp.!Ei͂Xbe}U;vܷ;jF&#ckǀ c l:LX]#Ӆ!a2+2 yHؤ;dz?t,η xèL&K2S]n'q9 ,MܟLoBWHo!Tܮs;v7m&S'f bjaM[BD*6k׆Iނb.t3Z\r5gb9y]jaAr)Cw ,GN61[ )NmQ@;Y: i `bp_H/JcVłRvفLH]v6 XL24, L% L\IslC8@R G'-[Y=FsјxUSҦz;dɘa/kW=&'嘛X5q{uvܮ-%p9H(Dp(Y@-[RJn) ((t"0 - BE/ITSHm{!hyrbBA5ZD8[ `-"&R ohG}+őm6k7ln%T/e0n(\ B3J_p@;׺WTTi:uVJQL)^NI؃[(Y$%zƄeYE*6 u֨T% ed*@-ѹ*0r9MVHOw|yi |䝁Oe~OX/}ZhWs0lSaOѰ1as<4G#ŌwJЍׂbު5PChCW~޸<}`P\a]l3~gC~s2L6 F}#3t1^]z=Uㆻ׮^z`2ɨrDiZ7-CXd>nR6 y/+y5V]& zQ]FMBz-HW7zy#h7+j%(Vh"GQr2G/)^G^DPdV r "0 / 6q\3!Mf8066ѱMSCAS+`p ;p3>zUq-[Vb)!{ufJWi!DƙxBC,`G8btUoU0%CF޺JwP@e[ƈ_QOX\?Xư "6&  %#*TenI1g!07 I7U26%f)OUj_{' z;zJ>PQŌ֋~ϊa⺺دn1#oך6ԅP&jFk$t~@^9cg~Bkgll߉77hD̤Gt+5xbfpVjgzK (MѽW8XrR! IzU?e#$FkJDzF+QWxz6D?6բ\nւFF.q}ɂoc+nlW*nD; yX8 /cP(^ĴvPmւxqMJ 2D]*5J_<ޑP``A*x z))‡뉭X-|(k9+ _bUOAHsw5?6ȥơ|r/7jUku؝ިqT%ǣjcPqz#V@_jMXGGKFq,2j5P%> D˴R|k_5/`[՞5ՀkXkXr4YܫٴU[4`AeuCjCBӘ=KWbugn~jCUD kYT,!#mUz65=8SLm*ZT\65 4Y0d(]'dRxqG*_IIx#aW=Mvd_'?D wnnHL}>oJB\2sIvɁnr)|v3Ӧy08u'O܈%H ctʍHw2Cp\)#x(173yapd<\t$l 6#f"j ٖATP3h ,pӢd9@mf燐vFnCu^; CEITzW*ʧrgr혥0QsWC,.OgaWu,`?d,`Z5ht 3,(az#.?$87: {N~bY~L{vona'NᏘr5bO~Yc/ҟ49зjm.R@:U[F5|Y-7nt$=4JjA4~/Q a?APyP8oG$Tb(ID׺% \A>T\?/V83# qG.>I??k:1JE/(!##dܰ/w?}{b&~*[_AP v[X.օ;nkz_z01y.C4zK*LޗlYjB%~'=]_,%hDt!}E0`Mw"-h9˾? .kAOD'@|^#DЯt/WȧgAHВYX2}nAdrzҶ>NJO6 Vt R3q> stream x=۪eq %mܻU } 1dB? gamIK׵OcsYT%UU%ϗ_~ӯ/_>_~?sw???_~;]{Nݟ߿cLIrf޿#?_w ȝM veD;ܙ7M27rOwʣ;t39?ЏQ}A܏'KyV 'F]]X4\jJ`,eI)#&șI> #Μ4gBOSXSx<ˆ8^*lh>/vƌ?M/*\=)J*_0Am,69ݜKK&痋ڡg ss2@a_PíHZXKFUТz4VwCOVEB3z%( 1[ 5\ Z }e5p58!!ȳ(Sk^sƾ~2^y0w'ys0D3F& d%jٶdL=t׵L=օC‥ b* 9 c b 8-*JM]=2( 1D ; Hrda2.vQ <]pFCc^QP<$~M.)ulAˁ,)}f)Y04gѰb_0_e|DfGCĔ x:X47<53t0hVv: *Fx&%iѰC-}qML/a9Ђ HgPd!N~lƸ@N"B !|qͲо`<6&6ݡq<r,Yᡑ.lUl Ŀľh|1N$)2F8yuxKr7KTv_{)oҜ5nxy/c|Ru|,c|~:ُ"ʳ4;曙>h(-GM.C!` Nz4F>@.@>@ X Sg=NdhȗL\y?aκcg y@wϳ_ y 2 >'lԓYcX bMJ8Z?#r]!&->[l7PlF9hCh95@-{2V|!E ¸zw vS@ǐCd鹏9r0T`,R+ \3PB IV5 ܼ3>NIucHRs}rSSڈ*Y= V'n VGe)%Ľ\\YUD і+O<%#ÛUQ[ҼY[86)ڴ4-neύ&&"FFeE51|_}H@\L o*9]ٴIET^_mK"rפ8|$GzTL:<[, !'=Jo?~O1~.:NeSCTxxA&*[/ɞn ڗ=]F|jHpCWiu Q7?IwՐ8#XL-K 53 o/d"SW4&ڿ?bLfVY5AL9PD}D>DDhEoD@Ñ"#E6 5D*Z{UZ%{tVTHG}jKg@huQlMEpEF/(۪-l#z\B̵䣯⹿IsV[mQ^Zn 4y5'/:@n vE\_z;&6/9cU +'@!aEՂ SRv技%!zxIE!PIObW.!r ˂uv[uzzTCm+A+ jJ4W2{Q"|)?PqQ?6n, *M4gȲzC+#gC̍*^@D7ۼc;7 b ]j`5z}ֿOi,wα(#^-2q70k"NW/٣Dmد&{ԮwQ(?j\C/( ECHE!F}/[Q> &¼+|D5Y5y=#E_t:V'r٢Ƒu*}d96宣=١X Q-OBhzTi8{1efpBxnv y ~ap´Mr&""-MsNS2ISwaꦖ5x(#۬}F0۬) -#߾NR N"L"vCԽ1s۪enbYd5MxCO@W4C~$~?mw넡>{z FH-7%uV˓w1NMH/OIs`"yYg;%uʧk*%uAI^UJ*=xxUU_hjxo]ʦbu#tu:Vߤ2RR#t SxII=*=*@KWfD ukNH_htxAp3@0Yw@o쌢 fk!S<8Qd}abJ1'*(-#e bkᨡRwnY_Àئ2"*k~Z$FCmW]>]m$Y+DzLf b܏'#4ļѲ5t8 㮮> 'Նቭ29 z7Æ؂e ; W7zƋs8 f0N.L. j>Fm;` K r (_6_OocÝ?ڟqSr'LGx\s`*)s_G7wIҷQ;9/ɗQ×k_ͥOv>[b˧X'M;  bއT9nlXj5ɝggi}\qĮKOs|+|2}=-AÂ,ِkajA jFo+#Ʌi+Lqo$L{p&0 B0 y'pFL_h6#Wn>\ =w_~Wjp߉X OnlrG~{8L* d)A9y]r8/0 s\- `ÎBta1zev\:Z2\Q2J5֬4,E)( baN[^:SG~?i:Gkj:璞eBZr*]&->%h^Kpo?fN[{:e6Pm=?ܬ$Z?Ƀ^ES^WKM,j9\[)[ާtΚs, AsAdjſP)6/K6Uo|(…yDqaC缈7-u-RS 82 }n:vǍ#ᒋyG C˄ D >|]9\C;rm fa4(/%E6싥NDeFc^faA@8;M朁2n]m7lŅ6p~NaVtzf3~Z_w{,fK0qKnʼmA<+Z,MAL{jXT`-2%4J}u vU<3+ƛ&+gcZI az V p[~.SJr-lO2ž i#GJ^,R,d'#8UbtU^P?]6*j9d_*뱜Ubb%tdMAU :j'Z"u`3u5*֜q~ގ^/?dv! 63_ suEncwM#x.ff~ ^0=잛=+$Ks4f܋klN. |`u0Byl,M#,v95qs6=h./u0.OJS 3ߡ-+-g: ʴG N#:nw%&julQh>] (GOC]YNv'^&Y =V /b^ ToJl9ȏE|L[fԡJպEl͂4ߠ7N)&lPo&*yRYӲu0)qr9`.}~x(bG͵/mes'苘+T '&10"=m`FOcԷX%p*iOcɖ\i*ndV'-Oy}Mh>ntB;a.~x$鮗ڵ6es}\ XQV]|?%=NN"B&pI]Y9H%Ĭ Xh'ӻ v %NAN!1,7ԗv^.ǁcanhtṗ[B ^ZwZnHk"-MI]X3Lxv IZFZ\Jz"_a)/#yNxۚ))jGѽ =dݖOέ+l=& 6<ήb,=ξ=.Vrq㖕Yp9NhghbY1lܬDGK#DjP#;~OٶIr}--%em> stream x[[~h0,bɆ<,~Xf!ߧ/ZLaٙ3G]U_'߿TO͗/~T}wӷ~Ӈ/?m]վ{rջb*!tLerǪ?3zX{E=0{腓e̸5ܾzUu|NJ] Tyy`߬X,xHLCAlXc4BۚSÔֹa”'fN3f+T-ye%~xOyJռ2VWU6Aǯᄏo /_>Rd1wdH-FMLW~xn2A~r[2O}Ţݧk-+Lmxw4GHnWH%ۿ}t :EDQ Y֊>tcKF lithJNiJʽ9\XCajg9\i}2 |6zaG hbR6ǻVʡN|kvĕTe~>~z_dY\X?o^'_gvO+{iO\W , af5K1@j-+#ʱ_[oA<3bKlR!x[I<̌qk&u u%`]G/Ӎƒ>(bQK-EbB*z.&1`s/EOpex"-7Jk[ [AU[TZCA+-*2i U?3F#5p1CȦφoOufU=Eٹ+rB;fk[KN7:5قHxQܪ԰ Tw5WnPKXB|' yB$N ՋZ6f6f{"2qU!k}w4a.EHTd5D3kXV3 4BY X 'Xl`5za//4K,N`Ҋ31RMuY"MZ湐frtjr-MַUmOk"O`^Q{pbw,,ֆP/`*{)z 5ԀŤbOjH,?3*f+7-k^%v P`ټDFvZȚi`.JSTZ`dF|pt?b⺑QmN 'l _{Ųr#w${DFQU9-5666 -Hze:#ɡqAjbYGiw©01vz .Ӫمi sY,p%&2if,$_32c?&E!%2"/39sJ:>z:D<@;ΐq/w!@v`١778W;;f;k~HbxΖz#x!x}S@!&ܔ㇟\J.a,!!@!@G· 62(E۲8LQQN!Lc=,S;5 H9iik@qJd?--׮Z-lrzT+U3BTs@@g7Ql> .r70^H M|8MF^@8MvX3-݀ Jc5 IxCL;(IoDt ;f<#|Y@3RizO0'}E0!h3IB lLڤ^W_l `]S9Z $ ZϵS_\F_?pp*$Dž ˜Sh$n%JʖO %eg 0|c%BnԌSy^t5a0U{sH1Sr{\"JTcµE :kbiam.#pDͧƮCZ+Ȭi_fH8I ÐCNz!ޤMQF BF6}6NEJnt[0*'R \jyݜk(2w608iư-@b7{kRRl'!nҩk@)nh *eutZHiDC2Cd;ݏ+oGvn2%=@sC)8n &]#7r2^i xp^_[c ;?KDfGpi [lK`#2k}ʠ5ZL%/5n4S80Kb{|7=;hSSt;E-g͈wL;ܯXr\ b!KNw$m\X "r\΍5g}-η=V<0;1"!0#tBΰaee?%al_8-{;0_076(35=*jRQhDsi[jWq_) 1;xO=C %0-oG+R`]+eޡ)haĬf<4;<=}g)cˡTvQh yp4jRg>TԨ( ڒV.Y#6HM&i-@Yi`$4"9#* dFo1 endstream endobj 188 0 obj <> stream x][$~_0/]Q.8,턄l!v[ݺf3RUT4z:?}t_O~퇧o>O_~|8}xׯ?p /HB ~?~3 = f~'bY"$|__\uxW|!,ފ7`~oeU/BnxzH? ya(Z1 *ƈ\8*vHTZSl )^>W*hNǯ^ӯ_KˇQc AXׄڤhg]37/7ҶZOվ>r@W[XP8,fKfCD?*TL=S"O8˷aTd gIࡦ(p5*^.NzT搂 B6KKh=XZM&;LLWw|>еg)=[&Gt<ϔS8㍜ϴ)n#WֱۇöDHҖwlɟO7?|~K V੬LIWx_]9@Ʈ֮Ǝ6!i˚vS H,, yE#hd@Ը-N-9p C$&ME(IKoޅ3JcЎqLXG͏.W∁A͚.@i2do+<LztR}nѭ C׽N]r#aF't9zn3dAUPfȓk@8ltF"YC :sS0GGʨ3s`@TGjSr<3J%0^XD[4;))WXO,)!!da#$Ԃq۷GuՂC5} r yiƞ?6{ %m@ßTׁɀ?vɣz5f7&j+NEJ=9&u%s%]@Kϋ(F8Aw=4=IP@/b!Z/&hו$T\[Tݗ1z"D{Rg J>G\7gNՕe4fٕ;?PR ʹw ] qM@@+\k)ʶcDm^5OЊy'\ݙ'n̩S[fdt!=sY9s(PV2DžȞ9͔9R_M]sǘ`\3t0 seTs6Bp\WBkkUltXZ{-,լWь2^qx9X}hCLa8y)^ŷLAa }O,ĥ+,8vp5BGL*v= -d}֤b]:*8ͥ wx8O>G{3gH ggBiP<58 QE{׫>z= dIE?kŶze#dѢZ2aF-f[(Hr=0|$憔 u٫72.l%݀=V>mj~R5EUޏ; :-_ebe2-PҬDJ`C>͌ Z odžT"aLXlkip[&?S.cfY/.!_mQS(:a˶RZZ. ó/& 2ݪخɕa=Ot:InVF5y{U6h5zj5q:֍q 70ګ02mRcHnB?vۗ#6NVzvi0KU&CHmZ b!fb{FBE-^Z%&ؑb[VlșzNОW#5);J̢,yb !AՀ!Pb&b[f| I9%ͪ<߮Men-ߢĔ656eR1dN4L{P1rcˀrt [(Jg3*2f@ Pΐ^Q̆0+aU$-,#VAWzV'[; Pƅ͠|9<vXOsasXӤ\XXS"paS89Ez)6RСOY., B3amlX1* Ϲ7nUºO*TX<>cG-3 핲J 3b%hm"_T&BHr R+SFY TVNY6uoDe9s,"OQZ$Gˢ@hwCm kSxٳ>T- >'ն2IV7kRa2U-Rs`2 nmC@Gݮt2ƾ%QÔY3JAѲczl_?K=_3cy,2 8=RsA3>' U2"#h\d48Ѳ@(qCHcK:Xaԡ,Z ˘2aрi3$L )q$u Gk+qGH6c߁c,2nYwI=qLT#TF4?J5eǥuHӼk(Ք9V0@ sx2aM:aO1uL!KBWL' X[&&hJ@{ X'hT$F,+S!ǩ&ȴЊǩ&Lȴ9bvS82T(P7“is8 ͦdJã!誏'˒$'ӂ=ߓi^.nů5d.Aʙq`n۹YvgF4^Ui b/d' ȴ Թ2x!>, se iC+zӹ2wB{,Ou5^t'w ?W>\Y>seP3m3;y|,躞+keI qhG+8w2ƾ9(+f $" e -%Vjm#5b\(ft8j͋F(a~j$ HPB!Rk;Q$,+(0bPA*Rk[oDQ xJqM H$tk]DVO=>Q*PGiZEIݤpdpMke/.3ZpUQאPpR8k,Tfճ'7|}:}䪤E=aB.^=> !g=1 o 7~js닄T5 X93])bGM ~6`?3_ր%5`|b]5x F6͡l؝=08{#C5MG%{ J.C6G}+fhnB*]CX^/ta3&=yTlr=F}E gLٮkѫ*xJvEӰ}][6_#},>&HK چ=ncR}L[lF"4pyzFqziU5{ڦ(L`uEKz+E&cbn`~Ӧ U96zvLFa Sif5"*iS K%h!E]^;ף1~g0u:]cpZܼhekZȣE=8 LS0B݃i$Wqp1bخ1MVK$ήc!prTn x(nJlbDػ-MĨD-H#A LMt$b-gv0//zmҶD^n^+"@t 1Z583j^ /krYǨ RYmabY01@$[ڶ endstream endobj 189 0 obj <> stream x\[o~7G;rxεh i&CvE}I(7 x9 HH|:ן?ux~~:|||z˯>|4_0;cb$r/ߑw?<g@Lx~f8 gDTqxŨѕ:D12>Q>cMF!Fc<hy3'y0)8e0(Ұ!1勍;2-Q|D:(#Rz D~ix*Lׯajk1Q":&"LHaŕ/o:iߞrHB\ɵ|^WDpͰм4&-{AX_f`yBʍh.aʐwA3G`fgo;Pw4 S{$l5,&>[Q-GSj!f F |0IU~S R#lH8VwnR4s}i/u}ӻq1椰/4;j TQ)oXFQ0J\UsTpjFXPڄw S,ȁb m)5 Vg9G+ |E\b:hQnC^+0Pզ+h6H aQ!0|v[TY-zR# urC^N&]2XxXn.3U(tY("yV`X(v&dFy ?m21m,Q^p͓@tx9F^R:Mky{[7E"* ֵ'c7úu0vZ ֵH==87e^17.WiN|кWçܯI {3I]C#\tv9uf8ke8U?6bOr 甲2l\5 UWw/((M]vkNnk^c=aײ F/=aײ# f Jx)@}&yТ'=+(#DD/:2 epn5ߟfm 6lߟ [qi$=b7y_$$0YlY[ Fr?R@K:sLĦ †\YH\n -:/@7RXC$oU;-z7(~c] vZ 赖%[^W{mޏfЃ[ldaƄIPCD6JL oM nj6J }Ai%z5QԶ Q*c#pQ5KP[VлeG Pn=z27aL.ҏwٮv Cd&n#V0' &:|dtʹUa'!va kG Z 9R制нdyg9{)#!37Bo0#*Uޅvd4sZzˑ/P'<) jCޜzJܼkjsGDfu7NR};) M}_m<,MX(xLͪLF rZ+Y= QW\)eh$q̾J0ZGJ"F%|xͅFnOj%n0#69VMgMkiO^o!kk[5=J.j6]a08ND_@sc4fu7 t :&pdL(Hݓ r KS fn[5ֵ}סWD{[1?]ƲlśDNv͝@h#7.l|ҁO&s$[%HW-(!,`Y#zHH7&`&@l]ܖsxЌ`lQ$ו?_6, Mek<F' g!_KK32!HnUt0˄6-GgAI^ x= I+nR "83\ߏ^@DiC Wvh-2P8m.P_9&?00\!NC@ kk顉(X0Sp#c c+I |g-DѸUFۺhFlA,`Ѵ\ 1PVʭs0Y.)!q6BZE CmDlꔲfnݘX\PXUb ~⫃e=4 U]>rq2Dzyh2jo|ݪΉ˜u7Hе@<$r2!OkVb*֘R>?˅(y%Dmo|5ٛrh};<5|R7Le76$vڪZ:%Bk7MIeCA%s t}}جM@8Y[ 2=s;bf̾ǟL|P>ƽ(o]=XC1zEL|J˅dtտV.`4+/u0'x+L/mDTYVub޷*cڷ*{pjxOXcLmu\s7sq:3k]KIp_M0C\kS=.+5EXMf:MwdVs\aJd[ADKVwAGU#6v|A[,S+/&[?̙Fo1fYѬ ]x`s`IfgDJe. 0SsaolS8.bi"TU{V밐i-4mlY 1$&L S[;/Tdǝ.dO٧P-_$M\(fcu`/1ׁ26WׁH/eB/㫒)A\^B_"_" EɢX^Ūa*@WRwۆ)#S/B _lb:eզ kݜJ:؝o M IֲA&yycUI_QXHIUǢPձgN簵jź,WU]KzI-Bpe$+'jջ(TO*i } Ĥ8[$BM p]khJ /[~jb ܱ/Ƶ{0GӣgZ@#=}'8^2O5}ѕ؈_cOƣ;EWIOTW> H"͇fOiכf0ρ :JJ}1W;$kbrOT#" \D/0 ;f M "$ѰAd̃b#d= "dn} Rm}# endstream endobj 190 0 obj <> stream x\݋$_aLWo3!!\9;~>UGRԻ>׳3RJR_?o?޼y?}z?O??x?||釟>>=i< o/prpBw̜c৷?߱?߽{ä@bh= &'`O0 'G˘q#}wg$񂜔*%z+`_s,K;c9ހ%sANXozd0*cJN뜱S/$׬cN3fOʩN򓕼c~qTOꓴs'֙ᄌtr<=O~qo#tFJ1Rb[)/X,3Gk "־2X$uKӝ'LgȎJk*5 F៣ڐ:gwچj2q C5'`)8Cg7y 3g oghb̲D)M"U6.5ێ밋h+0+Ƙxڡ%v%+烲{3l @fWv`mgZBA Yܐbjٕpթ#Ұ82:FG2WyOm 8;lB&(#_es^I8Gy7Q < *q`=MJHPR:ӂ$,z alAr|>I'( ;`J }7}FCOLb:KmyaBQѢar ጃd3FVEܥ,2Ia; SaYx@߁q&/'5J3֋9R:p8xc]-❁lf lǎհZ8hǺC-)4c4a3&n4cQ{ Vl; jmVl^&X5.&FLv Y і}hۓ;)GGt/NjfhfR;flGF4q>9!Py/4fIt>'7=$U^xXG=_ f?1~ I?]EL] 8L+MUwe2u޲гKxuƥb BE sP!z T__/I^‡)@+(ZyU\! U ga'hr|P{"=0HmsEʁ-iR2r-3"&" ]W=Q,` cvϏn&ŏ)3uZ@?3>EؾfI0kCq6#d Í&mkS2q%N,FbɨXJr156'Q3 P±.6^݌d(h?B~E*vQq*../b+îaрQTN~1&أK%8튥6|`T.Iq׹1RI˭]˝* jd[sf[ 7-:}$eaE@6@`sZ,USWx&ULFBC r!mn4&]T- \,uB2-g53~A!kpsrm~rX"ɕX6 p.D5|rQt}.ՆfÐ$ZC'β !ן+G+R*#wDh+}0&@LrD o;x'YXt C!#Lǐ?2͎!'w1$wZ<nl>z3lu}Iƃ1y,^bCg{FP0},[-\ghnH7P +6Bw-Q=GV$ODZthYqO (& sz{wW0ZQ״qvHR\tCvIJ'BuCu6ԝWcsX'1ek y,iFQP[)\ U$Nxۨ|1G=@7 I6y@Cs*ȵx@ Laa3 ]E?{Ň"d>'&uȺxkZрO›40:TRHQ; EDZAJ2HI&ڀ"HI))F)# %_kc;8C|`ॳcbg)dҹXU"'.< ]sr~ ~,:NV0/ds]0T/1@<rNDZh'r.4a ?orQgH"+MU*F*_67dl7AiE9H:,],pj /,ݬc4^{r@Jз#př9Q㑃#vKv9d`ZGXO.9skK)oS˥È<+TԢGLv34Ls8Lg fǨ# fAsL?LR(v'f+˭oT  !Eŕ[p('_s{?\ -tnnUqV -1emSo(%HqךuWLD4iYi@^~MP8~~x9QQVFl:>"~Q$()9vprnQ.kRm˲ o&(.K,HEtl-Hj^^ If(PAL>A{QJb"n*JPmE)׏pԋƢW~[^hR T̚N&Kj%/+`]ThZ 6R|I9W¤ڥ {=ak lJC8JɉM ד+y9;aiB//pk[;매^Ζ-65×ܭ _j1-uE¹ߊ]n\.Muu\3SrMp2]AHL [E8ZzU /&.C\\2AAj!I̤e_֫A0qKss l{MpdkA%W&|/Ta8eKE{ƫolYc`O,l* A,巩Ŏ],/dLlr=$?RX1x}`J<;/Wp,Wq.igE ~:š~F! 5܁EC/Iygto)+ j6dS6?@IT$錟$_/$b.c7!CIAA p$B*AeV~Š o*^嗍>TMtnv۶[ކirm1~W;dќ'q\pw279J?s!f endstream endobj 191 0 obj <> stream x\I cq' bĀApl/1tɿO&3MH:fiZ>V/?}s?]><_~/e+\O_pBw\c~.?Շ&$G`bzpr7w]Ռ9^RwB><7o{c^7%RldNG, 2$duiE9I~w_~umR/]Xg#?}?^ߌ;81wıH9FJL_"eft7ߦ ;T!;-/Fe/2p`AN09 g fg߁WqEq?dZV_ꊟͨ ԈcBE!0+1~NdbbΪ/;\87  n쥑+8^Zhp*u8'^ڤr:&-4#4/M@b7;Vsr|4%Qi@Tw ^QUqA2j*Spm_޼帵I;>4~^38- hL Ăsa@jo5zp@fKM!oj]&]cr,740L^ =S0~&ZdULlͯDO IU55^(w\e5ym 8Fuܠـ,SFG]o4k}K eX<>0@bKI`jwD͒x)ebk!4;$K8Iʧ$L+Rl*ԈP ߯5ό eGA(eLYTc@쀝 f32FP_( \N-x6t7|T93̮R.8{I Kr8 y a22a"o+ҝ8q [qP#B[#G6Tq2|hO׋xK@VPk=vޯ #WpVG4 !fL뙐Ȅ'45WrJN%3aJЙ/S`wdDpZd# 5|.eHOԃcX ?fQ2LNF(7s3b#M)ky4Isk_F, EͽMg8I@d;([ Ĕ;S#:))[ ȓN5ܞ ]a'zz8PoWm=e)j":Tkm) O +|n^X)X&~;ZaY ]N"  X߲ʤ|lq?\XPگ#ˌN<޶yՉoAz( [m)=ǃ & 1G(+f;$|%HD#rZ-pa$nf?O8t ~<Ҡܵx UZ)[;}1Q%v5'@+N6ihF(q.J |qfҰP4iӉ#.Ie&{O;C}7uw泚&9eG_&]&00 ٌIGgZLh<}Z=a[ S ,xiJp\"^$4,G̎5eA'k $Pf<4wTسm?F9]0rH8QkDUOp "Hj4H b3a~F j(t)'v~զV)f X$)5]nU,z+&V(Rk*ɏWN)ȏKLUMy]Ǯ]N\uQ_j5N6_U?(rk lAonnР ߐv(z_]恎} K*&[qcD)㪛ˋgLG5ܙ;R^F9ΌvwTtnɵGYl!۳=,\d&p.,ܼ'/-Ttt? endstream endobj 192 0 obj <> stream x][uq7|aO|4P^\Is; _FZZ:Ckfh$=_˗ϗ_~~_~?wv~Oz+z"su&-9sv/"?˧~yJrgwq;'՝έB 3}TEuR':sYo5bۨMJٵ񅊋 V_RqW%3UO ܜv*LoəXE9I+ς`gNWϧ`<6$89(o?}uzv<ן`0[̬Xҳ"X4unHE5U7w/7ʾOM_'BH'--| A5!.Ht~QPMR )EOBHɦyx|GJFx3;yJ-D5Ae 7no/Rn׷U<{oCPmEN?]v31>^ySu*`{U5Ic\}QqN\gM ɿDkg$5MGE{gwLm` to yIMҫrYPt^$-wşO0yraLW)䕻'1*xV릟&Qc##Z޽qtYp_ (=?ԏ`0v'4K-.Hѧ׋Q=]'ubׅo?{{{Ŗ6هSlj{ۉxqi'h5BٙF[3c8fcR4P^yV; !g3#ez1L7xQu~_aڹ%]p^KCO!wbSC(' #ܡúNozC~/Ft&הcz {,S#vkʷF \;5,F`[.89۪N diTiHT`aU`OʐMM'Kw':(qaΝDz(`U72nګGK 哆0vnFRJoЎ7s{+%)j1J >JngO& ~`_}- Y"2i.G6 7,rU߾hMh&ma\s;GJ)oX"wkAol[z_.<-ҽ]؝_S)<g1tg.vȸW7]\|fXܺ1~6ϡ{>DŽ")!f,Y4ᆬKD#$!\^a'{ÿ/!ʄF~W>z? d>"u\c!t'dl !}@\*癐ܙ n'ܳ/L$Q>;Q= .>i;36w;ot'tdHh~'>Sn{>gI/)Q0{D2[$YszZ#V&z^o MP,ԾkKZ/~= ;ݑBWJb)Fzzn&CߝGs:o0j`%̠~]=I͕{IvһFLwVMi>??}M89KK9ͮ4o;4ٲ4j #s(~GNZ;JEQ]QJ::}G8:HՍGŸOmEhP[)uv(ۏP.mzo7.E;g"С0I;\űNO `;MQPyh@a:Ei@Yg㌥naOS«>31'{{WwIUˌ6l[Glg֘ݬh\#{"LMz; ~tJwv!ll'#SR!maGnA?u&;Pn8I`;[̞ Ne+ENefdbx\P?[E5#4ڊTVֆ/ n]i >Z|Qrקȡ5|}YOPC ]~Avd.Eh_(OQJx CvBFd,QiPÌY=H-,=96wA5O)XefW̙r$gly ؊-&qXu75~%=Fmӱǭ68Tˎ +%snΡIA6~ܢy];\D2bN? e(FW4YL\ͯ_0Yg`-ƶIEƺkjl3x"Չza,h8@پZJ.yV)r7[̅ݟv+o3UE[:~s3K7xo4tͼ wf|m(*Ml}C7RT^vmUY=K.K 3| Bq$ɡ^os#.BwV;-'H%VwdLaoꁌVت7N> Y]+>S>}*ǜZTO)-szȧpw@y"UbOw]%{ 6B#>eb+?j?g>e[um2)P +|g<ܷ:44[`τ[" .i|=d[^3Do =:46If`uC#jlh YkeQzC'l &lmW `7(\V?rrHW0O d2P!G LJL:>KxUwyPKbv0pջR"$ALsZχN6q~rB-G|tA~e8>+!XG)YBSK2*lna#%upfFl`ês _V|`?["`Lx%J5XmNHkO+1iGh+~$2Q̋F&Eq٘x ^Gf])#~VDp;iI!k!Ф!bm&6iK*Xaa'o/K(>>x&?A5m fZPJtxC^hsm7L O_ !$ƶ'T CcP y&Cew0 IHFe \",0Y8&;܇Is!Δlܾ(.XP NRj<_duavG^UcNһcRtK }2ʬ WP eo3TkJC%g=UP,/ eo3ճU)KGEY*Km(NJQr6W]JR &!,H\g\1_[/pf,Z*6;A4HQv }iӀbwIMR-n߈gu^CYkjb)y Z} 4E븜~rrmd+Kpf<^v7_Gu%qKF ~XWD, qR*[=k?JXBĊ]8I/d&b::k-; TG!kb =\6CWj&,M5o5 Wnf{Z^]c+qhڗ/?ūX ",h\qS Z=Y*p\Ș-^_UpFj ̘!W)dkLHOaI`x)LlaaN1\v&2[C3 m9+T3eQ9,u*Gz~8`"g22@` :dtD'ȨnABoAw X!#兽 Yܱ,|4 E⹦|:#&lb4D 8p[OS0KhH 4챐V[FHHNpsEZx7wz/sP/>ŀ!i_A@ L' 졙BLI7a5_J`2o$i^e(ow2nLQR)XxfV6ްv/D-ɷ;_2kE6n o6!V眵*xHS=G+؈XK@EzWPkh5b mWT#<ͨ3f$P"Mo *el)jkS| ~HKc]1艈8Y!{Q EEh\:HEB>M( ǃ*."lpɕ9?`fV=/H M^ "tȦzU\-J^.+#-wrz4KxٻĿFd&d'xpa˴`N.;yܲ]vPְCU$_v:1C2XUes:>TNm xDMg@t͚<|ߏA4ElzqʹdVT3Ωv3^2YTշO7ʌ'(WHV`ZVMI_-l.t{">`L~tyLS3*x|)^ qU|&+*د 5jt GE{z2FОu:b֝VߦߍoK&$.~)yQ:E#;?oJ b:*N0!7]}ےBREu$k4IP' ?LMޤx B$d"8}H'hQP1r8Jsx d2QyQ(̩ۚh/́,IRb '*[>+oծhLpAf~Cmɩ-+/+_Wb9<<H[#!_\cx( .#>`Wt(bC`*磉ܫ̽F. AhKy;Tv7*[r3V>`IW@@ސä֭~JۑC!@ngh[ӻt.LYl$vAeXT!n5me nrK6h[{])`ㅄ嫪@nM[pVX 0zb8DM>4m7XW4 ֔a˫&TׂSH98՗ @`~9"->~/@ϟgzPsv9+hFڝ5\ycViͺ{Zʟ]5b]T 6 |-|ޟeS]9*w!eS%F?$f#jʷ Ieq* 2QPNP<4j |'"߆hxK|E5A.9 c*ysb58bxj`V(;{fs"9< xόF+C9}!$FR]nXL|>R!G\x6rH< go. ϝ!,Yw4ӦBmgV^!=벋T|(_"vG8Hf2lkZ&3Mͤ[X+ r3L 'cE3H_ͳ"ym(cRS,j̢ExK<.qц<6(xC^(6L؋7ceOUn4nrҸ&3D{/XD/ ~H*:L TD 2Q\&Be"bpM&`CO#xDV9K`EAh(3pR4 +N (5.̌ H+aV)~*'eC nU]nTe:]+$yv5TҷY-]b3ɎPenT/%BbTzELrSVf=|އe=QFld"/#9k豇Z8XQrR{B41^q3GZVBޱ 媧w AFKGQyؒ麢G~~b#5m1[2kJGԆ}kJiWΪ >O+meqȚvvJT2Vڞ(ӳZmgB$Sim1Km貴LjL\1_zۥ U s,Qz̗xm>)×}-n |`` j*r CR eËnlUt{¼6mW&_D۶1P'4 0W@ MOtƶE_@7S^ƶ5?`mBmu3V57`l|7zM#dQrR 5!,<d|[p^ z dL>8jYo|j; jsi>s^q=fr}}IK|1pwG~J椭}xKIܝm9Ӷ1, XTk9m/$4J!,9m/$Hn4/4Ug}1 # X -QŬNgkp)+ǝ8!,9ml֓Q67|ѥj6?bhL |n^ޏ]5"tK)nn&VA'tc2gЍ5fa$(J*lDPB7L t'cPBw B5$tnD]JrCcB|h X2YmhCQ7ebÔxSfT{1BҘ a#ҘDtWL"z""NVHOsBPD4.hE$N"pLD&T o?ם:6t-:0p,7,e|VTz@u]E-g{+݊'NY5g]vĩK]vRbĭ[j|VDa,کd5z3[L:uI$V9XXbvŊf,!+ֶvx[0 yMWmmsV#_e~Hlm׍uy]yy[z{jFűo/ws M;uڌ9ֆ@Ǒc?~^[#F+~ zQ:.G0R(m*tn)QuP9os3kKUun*:. s4h;A sa:775WϬ}&{STEvfyq.S*5w*pG9?aS I`PG<=*A$G*sіUxlNMXBCۀw`?n股'b!MyJN.۪Q;,"v:r5x*{J.*ܑ=F?6P s/")ښcYchЯ[Vs'_CC茆!]}4$9P8RpM\ ڗ\qݝJoj%q^ޯ=n |BܑQ(cnK9n"oȍTo}+}|345͂)" gDT @ )'}hPmVIsgnJR窭۽>'Gϯ"țAdP-zUmhN溭O=)?}4溭cmz:me&vKGۍ/Ib41%vy|!J`jw_t[{=kHg}@-pGytɍDY$4 c^ f)qsL7`| lNa6SI4-/#PG-=a4L[8U=B47mWx )ܴG ̇07˜+Ci#Q䘿ulZ bFq9i?|0ɡ1,߲Md8Y!ۦ 7Cw/3~mpƁQzy:Y(mSu3;/ W\-Pq95@mHIsXc>sw2tLQZ-SQGlEƭlda+[+j6n^fc dLd +5ٓ2kE6j,P䖣 mY+Z "Me `b-En9ֻ4rы5]SŚnkє7ΘHC-O6.tw|?ӽ#2pFc* HelF@$2(¢XO@)U05p\ELOp;h+NUT!ApaĕDY (qe 3Q%q0E%\]ڍ`2m1(c# AUdpeQe1p@f hW2uڢh@ A9bSo앁L֟GBf endstream endobj 193 0 obj <> stream x][,q~?ü dfvv1`# `Apd-C@^l^ UWWɪbX_>_?u?|/O_\n>}D/G/~\~W~NMK;'՝wf2OVT*qB\f|&诩|SUJm<*Ȯ_*$W}zbMRKϮO%!"w v1m]WWEuFll:W_}W.y| obc4fXM 5|GۥŪK^:~/ ԷZ}\f;M:T9{?g,8ߌ}~P^eS-Mc}C"&3װ{с!J6rDa]_;ݸcE;X͛23lO⋊lB<2xYA>TbS̛4zۭx4Z2Nߌ̕S#C 7vh4$fFSmRO-FcDoYQ8SjrվYVi1ڈZs!{wwA\C5zW, \MIs;sЖȬznH%aMsUMq)p&g•aWq[a{y1EzԹ*{4z;3><2/IԆ( ^pY>_ƐǣM Fϣ箛*p!&#$B1@ !(`#a:}El&7qBnt 5+5ӴNs?@UO.kkS:y gPʇ6gYJm_Y0]<zf~eP A_x+tadOOHԳ%vsv/ eY$y7GL<{hH'pMRj$Ào~jXњ@]lf66&Fm5ysb|aO+P)Mb?`*xZ̠6 ]]=P v\tpEl q}@؃=PBقzB8XB 1b8A0zd9ԈT . vWPIR*$t 0bn;W@E7%l>U~R3?MWpI%;XLwfSjm[XAYl=+,z٪|@$%[2BHMFYM+̤,]Ddv!D+MeK򪃶m?53СvẾ=s*ZO|?&zɴk{gF=lx@7 ޴t"ck$7YgȰ8UGC( @(Z1c,(?dq`,;-bGd[<(?jKC@!yd'fKxsΩP++t<{]1#Jz_%.Wrw1KZRB^&j \ mQifդ/RSfv&Z2MJثnMNIJI \<KJйrX0 i"J剞Y u^bG(-eNm%J݂8rm$UVݵ~V1tFy ZƘ ҡc# PcĈSС&,.E}+!D݈y=)u6i깨#_1t ?bWRosKf\,d=8=0v) jT(΄'sPƔ0OT26嬚ٕk7ZR_fGܕˑ4T"ԍk 8 FVg[4l.&=K.F +͏#]{r!*W H ^\RN.7pA?$7 sbk]֦FWJBlEyD)ϡҺ#-!aK^ qD%E;i•c*"L#ۙI'CQ.B,Xcd<F/H.^/xEwKOG,"]Xd^SP}=f5*qIDž8@xp`K{I3XSQ$#fs=̠|h{?kU:t$)6-\‚{Q91Q#G=31=W$:i\@ 5O;:ܿA0⃟MXs19iA2m3񱑵y"|nLpG6Eo'+b4Eyx!YRn}FdEP=C_<`tu3bpP.4i|h@+Q y0H_ |\6q< t$-[L)*NOblaShz =NgS1-t/yyLq'5SEh?#q~q옪ĿAv\] `'4CŹMc$a_ :4x W?@6n`;@4c˵ԯӲq1U1;SC1Kˀc]Ha[2|@,qo:tprq!1CJp(x!n7d'*8M0t vҀ!4p`H(M0$A .⽮?(>JB܉+ DKuaiMٮ+qS]9'Q<ԛ.w'^񱚿LQS^Y&%.-**^(f[&hbٲeR&ո jYQ*E.帣rTiڛ`ڜ_n.:F^6<יK]\1A U.0*DJc-F!R?Mr'V~FYRSܒ mG?,5[Mr Ue(Kx5QMr,ݯy FWbanjګs=܍J ڮA -7amsz,6 zJU6:MSrde}f;yMߛ'K6 Dn0ҰR) 9ph!A<#4.Q"vV)Z)M36j zTU4تtҒn֕NguKŖAto+KOdc6o9f--OnX^jKG@K#ߘxT;,.>2RURF]NP`Gm6@M\&Od-24j@2,sDlbUs>mD[vz]% ~ATu>>ᅧK:"hUy';vܚ^3֞>JGlVŧ3[T[B!#ZTΩ&VPά`nmiTp WnvY`muEb?4Uilr$1pM=TEOM:r7n7pڲ'fXUwۖ$mā LVU>6gjӏ@,yP?3/=X[{me%/cUi44Y iҥlU\'!lёۖ>%WIzK<S@3xO6ǣ3^8>"|jC՜+.`o $ג"8JIАjxt$a|V ãYQ!h*Mq8u' t% t&JϨ82 N])DS=39<\+h{ԥM7v +d$_LR;%s2eE;$"mLxã8htjx6}\m=y>3 Y`Et4Es90ɘ r9=:jӭS|s+!0>r 回EH||>3L#p|yFmD?|{F23H0$1~O3.!:"'5e->C?7)tO?j܅L}#[ >< nH@5>">A<9fO+ˣ\*>7eig+mm*ø-b2<P9.M-9'C2Ǟ1o-ԐK^DOڈklj8ώDǙgAEl5'4d&3ŸKIgIa63*> tRUCed.֒Q8DQq\eȠ#S8ZPFp 2P8dĺ)U"(yZk< eѺMӡWCkOw"ChӷFid1h( XF @i`1N*l1?tGdvy»w> ?bpv&TY_|31齪qE|H-Ɖw wvQŇNSO1K?ʭMž`<^"A5#;]op: MB بh>xgۑe&gxWkxYHѸ %Owl+!4pV[M c6 A`[ۚ1cQܢOح Y[3N K(f.8;MiYk`&bP rPOxEQJ"R@νPS+GdNr ՉgvIM0*aZnzO6~pIYBq"q^wەz#Fި;.]|Pƕ<7;>}3ڽ**iC^,R~Vܭʂ EnԪ5f3xS, KC]匶8Xee">I? ]iImFZr+"A>nx}kqb{m\Ne8]NDj*BH4p<n:|k2ܴMr&фNDr[޴{D#ۢxMM';o3 0BGmk O:]QqWΠ[)ԆFޅ/'䇕sS_з݅J?ޗP>Ӄ\Al y'28J~hk߮_ld΅j߷1~t wgсD뎉Ye.\cMdIP:[fw&,tMn!F)?YA7>5&1֨Nsrc|iі'{weiӽΚ\8+ShM~_tڵйݠ kW'zDjVpL #Oa93 g/JTwthͽWΔynnvA;]EI7»tGWMV=%\ɮK<4tB}( Q&>u1Սѻl- h‹< d:2MJy?EU㿞zS›Ӈ:C sq]vfrSQݡѮӆWEn7ҪRFn+L ~dwYɋ=~z꺚fazV_4w!OJR R\im)H ZPE>2ut|j´S9JPf)^ TT*vйr1?;"CC?OCzç2N5_ګ/Zljhf qc9wZG^t_G<4UvVAۋ{j n6jdT(3PL96p(f|o盺 Brxϼ.;.U36iܻ+FcT(;ttS ۬ mt7|?խ s5tS98n-:Cp_n3#ȿqEtXs|E[ٵ]usDuK/|2] Ъd=BDj&0' ) {Lu9וW===fkߥ|K #SpZ(5㍡q`xCQ m6n1n H5:tq0`rOH\=6 U3P/)n^ ]K{{(qZWXU]KJpW#lᨅ{YD?v QN`9w.W8/"{t$/mu+f[/ Vz{;&3ɻ}Ξwdu9N[!oio &c3A8pQ#!qT}ORj`6i;_]<0\~wIq|E~!C5ACI?b;Ngke;I͊EtP]+[!yTqf[H'zO 8U\=q_pOm&M D~)f]v;?H2JAŧ^IFGh`oz$v!b81//)v8FHzs Fȍ'"69ә,M~yoE`/srQz 1rgAFY/'tw7K~cpUF _t8†1@~ޜۓC ED+>S ]q1#(R&qi.͙J"am\ڝP=vu`1A|tirfH،{-յ]LڵFz)L0D1!0cwF$@$HvҩFr}('(˿'ˉp I~RVt ~qT4nmL^5>CZ$ `ez>6.a*8{H0pM'# ޓkT~?[ endstream endobj 194 0 obj <> stream x=]˥ml>oa|:!KIs$,Z9K)XdYd?~˟~//_>?׏yo?~~/?r.>~O?'FId?ӟ_7*$7vW- W7J$+93oݒXANq'N]dY(iBY]T57Il3rS$7R9cL'!$w v2mOAxRn줍: #D6A~sg/?aql)uG+RUHXf6H<}-?N$nuV[ݔl҈L\ Rٵ dn!pL'V{H.4@O 펬`D sYDH֊˟,8U~'p%jf2cDwc`](Cd!_w9A],HWQD&Ϋ&KjNp f& _aPur'Z67 C:%!m51tMXh028Ea=j!f]]" X4Q;נZJ''Mѭ`Sx Tݳ!>x@v4! N6œ$3I F:N߽n?~ tZ щ YEM̅=yI9Ѐ co,Q* ] -zA\ZQFp*.òhƂb$a,hWpoh8L[ I|Iy6j 4} /-0`ᒻK> !Q)VrN$z FO=Tl2)E#lĂ(PH. e)w7PܒQs*=3->n(E wg ?B i粜v"rQH2sp{T22\ul JL&BƐ(Ϯ n*y*,XJiR#)x'n-9^(aEEQPz@Zկ_tl\Ӥz RQj.^KʅK3>EI}eeQPFApPPPiU W lE8zY,uX\,&e]#(Vq`l[ /20SUugzg:+).4.lQDc9"M'jbEx#U Yʲ.EʀKʨ^Y3#J6_֕LEEXs)]UOr ܷ9y]xꘐqfTjm3ϊH\D͹RRuuLƹFpWϻ>9.Cldc늢|TH6g Y{P菇qU%*VCՇ!N?PF`!3JĔ#^0ϊ!.@"#-y{QE99lxv{nYev+5ʼak^:hsCou uW|)OK4)j 4>Rщ\ (T "M(59Oh4EF;q= D0HK8z4 ͷN߶yF*KV// ;!W?4pý7ĭ_$\ 7i>+n%E ~&=N+tMzleAlqt&IlD/ e(^dėM"^d5^WXQ+E\%[;vD+GX0G AX#B DoOJcFX.q>Ke.-g":`4CۆȖqJ?MtfmؚkKL\~~Cjr>xKpv:FW5#kD_ [ eFRD%aWAW30섁Cגyž#)g"uM ^C`s:4?BypԴüL>%vU> oK.NEbL[G[+Y>̅53JHЛ~oޮdnĸ.nIlĂH®,LFBl4N+qjPl]$bOÂ]՜y_ri5c}챐>de+*K1a׌o 0 D6|D@Ge.k*XOxX8]6{9h {<뜇WnlTEY]I{\޻ sy#p0}߾:p; Z 8h)IAPhjʺ#qj $̹2(u7{ Jzn$+fNh˅F}.$HNppFzu5מ)שK#@N3e{(djav演!H;˹%E8LؒZ˶[LԐc-&&:t)Jf)U2|n=>lT|ⷖx+Sql&;U3/&ƌlPjRV@kt.KV>|Ɋ&vhAn݊^)hJ\,3V4%@esh4U&KoZFJDś&.;g>] &37D16F)4"qʍ݆:۲@'%^Y=$ER/tVB\]n7 z,k#ay"cvr9q{ Pr/ȭ#A!G49{߀~7qnA'1TP ʝ0hggĬLқ lGj6 8c\o njLU'LV,UH" 8*4osЦH&\F1d3_ns7a)T `c 15cq{=\&.) M-]l:#5p}wH#!ю$Ag28ָ)ϱrxmd`P*=UP+ظ@ iAN/UA&qB3\ү (󾱽 wywx5݈-qR@Åcd>(F$TX*ƞ."L1DNkr'V eC1M^g IܯR:->R"iEN."ŀ;MgHTPCذV yљe8/h@pD@w(:. Gu*Ȣ;k{uNd#oƌ ˛(YE}soXFެSfJ<]o6YxgdF={3'l)fd-f8l,eFpϱ<3EH=6”<#} D^6Utu.rj0S!oϏLjw%h8b %ԣk>ChN q: Dsjv.. x{bɇ#dr68lEdfl϶מm4y*9YC)~']6um#m0r<NMf(Ng~<]#"N-u"Sֆ <+ s}D$۔8ާMǴ`ztxnn3H!P㸍_ @~Q|\2{Wx?Z|?'zg_ϱb'x}5S[{!ocGQŽ`z "n¸5< zǘ|4t|։7q@%=阁28Ί$m@+@5'' DG ܼGhGOCW/vmz@Xhdd‚xߌ 6z,E60GWMěgZ4ZLw1mBvmxЁǝhz0]bklSs,j3+M曚(ޤsMEz\Ϋl3qo৺Əٛc"؛} cPy%/QaA,p%vTPNLnJ@u!^7$ucp;2Ou gvCw]hsa%<=IQdڙE/ /8'o#S _j Gbot؁G?"H%igE@˜ t v^f7P_,)/}m[~iEٵ8¦B#n !W6-B0L!IxoBxo_b b_ALj.go0UM{ۣ51#J(nH| n:)1SJ_{M% R0xƴX%?̙F*;K S0O‡*%4S0/ * !,*N? endstream endobj 195 0 obj <> stream x=ێ%7n?ǙEF \Y` > c ](T( =.IQ$E裏߿?_>/~o/_Ntz?GOGO蓶dߑ/?Fn⪥~Fd7zV\ !^ə/;}H 6.Kr?|`?@ǑeԦM㉊ Vo*n$g}vz)cMSx|"sVn`a?~z?t 'Nڨ0b'޿w?_OxaYϱ"p(u>H0F9tz ͉j ~mJ=}pZVٜ\%Ӥ &E3 gFq*8^D@}.&:dfbjъJ`c@z`nl&Ƀ$j4sx+`ŭ*ըj'榜lSccTuڂıW\H‚9GV6"Y tm~[$@Il R,|4ьPꍿڡ\3FgtD\sľۧgBtV%F+Hz/c}=9WV2JaxqgQ螣|XfXqEԋMBݚcwvx2F /YpxTj.1]kK'nd%/b q@Gh9vB2[ 耨 A؞n̄_%jL̈́ HV 4JL5BDnwLb%Qu>;GHν Wި z#(vuP;f hw\5Lg\KCg a)r̒6t>qcA`4$hHA(hDıF)~0l t@ ۅ}f`~oro?V1=Ɛ;>w ՄqN/ ~i!dAYQ6֊N<(CJ%^``.SYsT/f)Wj~q(ӶnMF ¸F( n(*'m$ k0xJ p~H DgSqY({pQ^{aރ&)WkwG^\=1zd"uwQ铸ø+>0$Hܕ㮝Q܅ cT\%5NL)"tU  Ȍ帓iڞa$*}4Id 9D̓:|S)C%oԌ:|~dȍ\r/7"gg~%gɟIY2ˏ27fK~;vI/$߄vbEӎN,+&Q,5pz \9!/_(}rq^`Űsl欦).I2Ri)B7!:+T=±Z2gYY d=\zꘓ:њS/K ! FTrYM /]Aq}q=$, 0 g90/AD2T ^S]( !UxS X乧NewH#FW &#Z2_ 1G3Lf~!S`u?fEVOI`(~ (~¸(ܜXu?jb!~VQj,LFd00q̪)(;l҇>\t?O5t t7qq~4[r?u˂K ;܏9FGOϺ@!lv~~Yr? !Kx5٬]N YqqZ`o\S:',En`h;PoP vw#ay*KsTT"q`6MZY)Zq0V+ra#"vS4YJ^P1쒩J>L6ۮƕ:_\ ޑFoݔMFk,4_$&,60$ոN۟/Xmx!`m&S촟i*oDz c,}Վ k'c֭RNҫsj>;B;^%g*J@גf+^ati,|U K_ѤD#P(^dNaw#sG8|KJ;ɞNvsͽL7Ҝ*(I6=2'iki3m> QbTYM,E8c!g~ㄑYGaw{pՑD\-/@6LN4L־=HXcn^d*sg>nd\lY%Ejqr63e:)7nЫ^u:G3Ӎ~^3<3BlL/jё5eΧks6?1\Ez> qyS&\lܵrǑDcj|tqPfZ|msK>r9wKY-dX9KO8=c``->D"7sa6Y𛥹JGV'xgjBnTd&,2g جuXdc +΃4>f[0 +17 iϸ諬F.KZ{Ѕ!CA6!I<>Ih!O~?r-=@T r'zx<7z.%=K=WBr﹬f%Ŷ; J6ru4>2uû6MnM[կx)-<~U>l klv6ײk<9‹r(}X[Pgs8h+ub(;_n<&nn 򰤯=!s-c6:B@T8K⢋Jcqp=+0%6A Pc׭&e3S4|< ҙua|_3L~f:c +w$crP&crΔvx^"OJ|*m{!b:rAOdP1h t`Ҵc0iBQ*&ativOp*.ucjߵ~ji}C{(dGt ȇNv/2L]e^_1w W; bS@$z r]؍yN8jjMCa{ȴF/YEUߢ.Ck5vPU{f`7?DŽn2ap\H?qve"*) lEZsr<@L5Ф 6 C!V0Eh jMP9a0Alڃ fT)T)`Xf0LĂs[ ôTbm7Ӹ %vSAD]C @ 8"msNM\0 (5&@Ų5`n tBgb{Q~s]JQG(AɹfSt®ӯ7[lR^Ur6&[դ7|'B:Oo XzVMoh@2ޘ!L2$LXzc) IXzc)> Mo 0eý=gi:2}ﶿdؑ: d&5TeFڋ־%vd6ޢ#S;y:td6]xd>6Ol)9X|Vm#&zm6S>Qr2) eܐ 0iCfB> ݅K5o3ax5 FR-ކHk1u:eЏ0ɩ\smH?uA?yz?kYa~L`bS6F1;~LmЏSJb؏9^Q6ǬQơ3)J?)J+~bڏi1T3S4o+ECBj)K@% -+cǴsJlǸ}?+e?f5-HҧHO[j1=0È'#@YXkq-y2zF ͼ;܍kI\9rvf[^7n;kKN$t[<wߠ6-#kگxDbi}5 (3 T`1Pʕ܀Q_g^v1塓Vm>yӹb] J#WJV*}7Qܵ}_[Fytw1:S2W(xot1HEO4),Y`Xh2Vk|n*߀7a+0h=0&,ϽsY)w>UDN@ 'KzS>2^k 2]kjDqOb"ր`Y>1Z}kN\ڵxb~ǠpTwL+}kxX؛@iYPE(,:@`X[(}DFc k 2KxͰcA4.7;`@=tO38Ck@QC9xX+2֖CqU?famNY5xt:PLM(_Nޖ/Qƒ%nP &ɪ«(z8:>x{ ϔ#n{2`U1.TY^a5E WPdMJ񶲉RJD@i,۫vT{] pWY(%9V KʅXi0-րΉP Rtt-LG5H_"Ϳf'Aث1`TN/G߇Q͊%>U;ܘ^OeF>6mqAN٥6#c4A#J;ĸJ /1N0A1BMJ8TbThǔJ -1fLhd'<%7#SȧϼccSQ.:щSNAbM+(Ըpj3 pD%i")J-5̐wjdj'=[ th TX0tL endstream endobj 196 0 obj <> stream x]K$q/0.f$O   ca!d+ #g03`~㗿?r_~ߗ|o/t<}ݗW~/;~a"2{;Jq߱˟2\q⮞L>IsL;]=o?\ۇ^(NT2Wsq>?O5Zeen\ޜbzSŴܮƔ]2U30]J\6%L\W`򴾊Em_F?wϗ/|_~+Ic{5ZN3otSZb5D>֠j}xFE0~u3!o*; lrj.e e:C? ^M>RK"BUm+rJZ%3SlYIVd8VW/I}G ({s?2 /,}Mr7GY{ۂř&՚cʖ泖UN>ѫP5wk {ىoܯý1Qg $"g3G yǜ[et{❌D_eo\/H^ϗ5ܿ^˺/y@|b<(DM,U2Q19ʍ]B% LG; &% Ʈ;.(d'doR-D)]$s#_?%+U")]wG\Gf~oI`' ~O•6JjɴxbW3]]wU-+!OxdoW'?|ݔ}*7;凐 ڣզA)ݼ̜ %'gf?!Uv2I \*|lNSypJ.vUU9pGHZi:8⨄33S\=^[i3uFcՖ Sv& kuj֟"@q\-oŷvE`Q m$3ݕ"6⢻[3:Vvϰ]pxdRL%u ؗ((|Ax΁lHԎ$( 6{UHvG$$Ob1(W<|y/A$p>z}8pnȿI%WzRO $΢q I0ڄj<,S ~FTm$E`Q(dB5i #.31dP}]܄%H$1%hVV+PAð@,lb5aŶ(#%1-b)0ObV2pq O fa[dqy+T~ -xbrHB˳♸bk@1P ?Ӱ"S,ܑ ?b[C?l-@'V#`aK'_)}_ 88 ^9e[ =F30m[ =RBi wWbK&78okř.IN`iӦ:9C,o V`\Z+G-}>鞝Zp&rֶl-~wf[p"ά3z skf1зD6d`[$!7oB&1F@ xѷc7Jē z&hk{`Mf)XVV$HSL`F)& Dь~ѐ"Jm,to-Re?S.e0uϷvsi8tTMK gȴ)(ZK=,y>AZhqv`xpo[/Hh=SYɛ0DZ_(98`y!ZeRVN:`߉9B ׁ(@juw3FA:)&W31F1 VnF谆q}/.\IRE1:Sֽff55Y{br_lc3md Pr9m0я3$8z?O;Tӗܩ0c|Q _?xk"&;W/|\l7N99ZaLɒoH'WZ2$Rfr-R([JlsY,@*<sp0m\v&p͑EtX[̷WdpK \աB\N ` @qTS%##>uKp rIܲ+rnSG]&o PdLN픏$SC6t6ށ5ڑ@e cʰ('XBBd'iSi DRSSD =t:@F&2̦d tf_d І,2uP4 .(IKhR׀bK Pus6@NS0N$[1UTBǝӢBeD3$<?]29svWhՈo:zyw7 ƅ%OG\XulrӳtΦ?>/R˰ wU罇ρO:^x5n쀻<i5ǡ=|S"E&tv(e+BX{ɷߺƍ~Z gwjK*oga2;xة#Ť&`Iʛb>T{ *H5iVXy+9a ;q"+ostl0mRy:E q&r;.k}| AMd "OywMD4 uljƅ*%Nϔ5-b2Ș]?q%VI2^%:-喽x+*_~Ak?jEdiz9oNo'd!S]I] ˷j3aU=]W-k ۂ|mu_jV )vLWrq,n[7ћRn; :k,A;tPNvgM}X^ ;l8WCUoM-[[SaHoZw'tJ{z*vkH/:=-,:O]E ~|X9ZCGAA]U%!-¨RiEhz:.SpR6rkfm;rX[{%83.|ϐ V,5h5eHb0jC5QL&q{]jA,`3!IҀvz~6{7q{BY'{y">6eޫ9_wz]EPqqۗcf{;ZwZow~&!xi1~)&N#;}0a4-=<_tVhOu\;']~wLMnDМr :}aLF8{YKh|"Q+ ,G*.`r{TӨjr:gR.5A q#\NzoMVҟjh٣>;g;KERBIKۦ(ؠٛq ĕNF)ߢObj$ͬ-}>}&$-jqv9rH3tZ6tȁv)'ovk}uv|h9׮vFɏy츻2i#&?-!((%ah6+ }~ZiAC LZ=:0囎ZﻺR'@;gw.): m#i 0~v"[јFpb{GDXQ-KGg?)nO4(?O_f}R050L3k@5Ğġ5  Lt% aEupr!;.I')Mv*X NA"D(q9޴W$B_l؃Tgh;&G&2г~c\Z"(T:Nݡ4ohiOOO3$_2ߣ/99mƋf9m9ZpClɣfǸO44ZoOTF т¤ oַ1Xi6ş^> QG?NX3~w:/ yQ (6(PEgTy +8/N(':/sNv%J IP)Ќ AMBړD4X" Sŵ 42Eu !Q!KĄ~e]魄Ƨ-n3pDApKc;dDFOϗ??S1Mr*%*93Tl 6Ȉ֖]T}4a[e =)R[1vUP ]=m@NV̓E*TV ]T^p7#!z B]B@AFH=ieH9":,Z*&^&H1^ 6F:{@z!׃F*:{p5RMWf^iN'2{M^':A)-):`A41PFW4:HXvKut5 l:ޢ9BlaD@"]- ' ^Z*Ҥ6Su1O|@!omΔKlO4P<_x)> -o3.A( A $d $ 3N1H$& H +*HL8A@NT88QA 34QAbS4 /TdҮD|rsdvD@"ͼ]U[N+.w KBJ%} \T-BkUE}VZo65o{}di4R?>qI>KBoo pho.qj?9BRT$RU7RUgܥqp.Ղ|m(p65XRŷDwn`R=(ȳW0 ^ .@͒14FYw{SA%)L{M6r.8bnojhV[~Ta+z7fңog´wA/S۶̉{W{^Y[ܝ࿇ݩcȁ#ݴ;$$x{ ǙPTaiѝ+Z;mY=o.nJPM3G#[A#kGOꘆ|)5DXѬLVY=M W]G p M4+wtGQ|ER**fJwo@ ?AV*K'dmO}WP`R1iՀU@"L\`>*HlӁP3+|' ەEٝ(¸[]D" 7-r:ުkE~}ݹ*Ƚe/;\$ u`)̢ sˑ?rl+> X`tKIt2wUJ}NC*̽aH=o5{{]\gJ[%ﭒ]$3s" i) zxq)6t82K|ӕ XKnڊݹ(usQ[֕9Ӆ Y9Uӈ`Ay,ǀ?ޔ$ ㎑jFr X7 Ċ b!4&;H6Ѭ!$my9&z" pu.@V'kz0@VRܕ!LH OU;n}˄+GFY}74q|Ll%K̾2%wV!bzڏ)+*.ab3] ^Qv=C<}J>BY~ >G[ӲsЋP%}\]?"߆?'>UMPn?6 @TW~lY0gWDT0`N`|`~9p9 9yb5氀#qh|Ar>O58l~]2Q đ(;p6솔 (ѫ%WKb+{m$׏zntPlįmStcĸwDN!p d\8Xtm:(҉+2z_WH8IH@f%ɵ4XҴ}C.L[4wgxgnfٿz e{c'LOùTgoHR,,\ YF>4fglyWcb]K>+)PU.K k}"Iy@l̰έmݹ~ (wK26Dj;3+"E38I4KH):|$ `^6( (M&O#RVޑK:|guM*5ߔQ>`Ѭze~3&U}@k-ϲi$śkTo\T/X~!HZq PR׊`G+(h!DKuvUWsE>LR})%z9;x{;_-M|q)%W_mZu/I'+tX񲳋Bx(ƫ.ʺ+]ߚ{TEIvJ6`ElQ ;8hVz{bE]" :Y)TaOutX{({偀38o||>Z1]czm3sõ1e6 /\ g'Eph:S!s{g*VbbI,tWoԬo/]YZS,DRDZv'7h=NZ dDv"#Zb5h0]5#VR~޿nVmDC*E/ukgŒne>Յ2Vx_߾'d8W3)UןǗ_ܟWg&/UoagG/H] vџlS#s|tɟc%ey3Snگ= 6sЈ@A ϑV?G}mA/MDhANfş\rXҟ/;]fX8{S7*?e WAs{uI?ӣ| '^}'eQ,CɎV= J>+֙,>l'%e;0VRڎP>m^1Q\[9A`1 ,~U8_D^{Dn^+)% P~0ҬA[U^K%*Ay&| U~U̓a_ڻhuVR |tu>M˦_c+);C/Ovbl<Xy`bE䁒=K?Fv~ԑb5fȐuvFm`Eqp7?bՊ'WJpHⴑY7EF}th`f /HY c~?qWF ?L׾B ʂęw ^s|[Oɸ]l/2JI^*D}_4v+#pŘf!*"FWyο.~Ynb?ď2{v8Bӵ.p]+sfIZzF~)ivK5T|:76Gqpxv|hLo>kG]~9 řuZ^&5b3^UҎ0bu4 endstream endobj 197 0 obj <> stream x]Yq~p%#jq_AY6b# `a0O! ȿOdsk`լbX ?~?}?Ouo_>oor.޿'{ĹZ>iKN9wBQA%j?s/\(Fo܊!D+93/oXXNp@>06JR6Y_8 b⦨IrgE,J傝Q~C|" sV.` aW ;iNˆŞȢW?wz3_13Kh!ӷAb%FW'Q?\v"/?>˧=%T.բIK0U{Soۈ׍*X6 1'T:kWNYIЏyHM5L-誉I涪Aj-Fa)!Y 3D}7_]5-ˉ&]4=Њ*؅Z g9҄j¢4AhtA\3ڰ]iYk=[pћxCnIm/Ab2\<,夗|Md=k?wp²ܙzB(\V (O&˝3$2L\-$wrъH jUe.L&|1EBP* eOmbJ(f"s>dG @%'OBbrvQjK! \|Va)ӄ3#Ze_'^_C_oD8T L>~b0 >WWh./w5G*_wխQUk\g!)$]/D+B M &/@sl!ǽ*ٙ!\ZL qx-?w1#̄i-jeMH}Xg Ejzm\ y Ix΅ .$cZC oخg(ϿRΝQˡ|xЋ-n}鼫v~ܤX=(a'eN{B!Δ A) E\-; חٷnfZwS֝12y1)/_0\qӇ1%#|z\/7\AYs w)i<=jC@υP,1 RÂX^ݘ)%6V=[-g,ҕp``(nZ\ .Wѓ" hڍN N+@+i8ܪ\fȔqxՒ *Pբ72p<dr*Oo?wR #?/ƒo 푸8pRX%uFRD u0F:]fט!~$m<?R~=?k[>~Q[[PIúv1;? )[Vek76:G28d /¼-4X6ldwgV,+f C_]_GRn<|%5s0%x8N~J ^[+,&`ְYSbgcX *uijwufutApM$ p?nʕ8V8 LQO;|C:Rub~/iE="7q`dWH[Nz^&}acs4]Rmѫ|Tn/JM/.9mUR{eY(̪VtwS6 3 2`%] mWB0NNd1P➞>q~V4<q[sDbN\QxH ǸOo34:~kI@DH6$ʏ. ؂"Fud w1ם1mW9ђ ]u5)/J,Csq!Hg hsϬO;\DBg,a n|L-o :TA!iF;tzS*|0YkAo U`q+f>Gr))3þF^ "3QT&' ĉBbf !ĂC@+1g,Yi3?]T-7X7ڰ~ۡ4bO8{!fqVC(X8iް_)Eᮂ9#l;Ԣ%Ĕ9e30ɮ50K:H i -¾- R S\fn+@G ڂ9 ҶLBp mYp͓@8VqPAhaD $/]i~9b2RLl)Ĕ-׉&]ftad7}gGe M¾-G,`F$[+kH 9;wPz=7 [Dx5MɋĖ7ZZؔjzD pȓAN {U{Yl50lI>tg`Hb{9yxu6j %QKP<.z^"VORkhkK 0&Pd›$2vEJV i! ־+ 1Af/Li) ;KK\jV\*q E~. azPYqU$Jy=$ M Yqūą)N3q 0(\ )90Ur A Lg@@ʠVTroq}TtfsV>N YMtnܳ_7JWwyf{++swoVk Q`%}D 7(aJ &gjzjsͭ{FfRZt==xtitA/Emm{ &}2ߞMs6=|Szܦt~l3 H0n%Q7_+VicFKi^Zo;.Gj>QkBx@d7_'GK˺0Nm6*,J vQ; OT|vzӂ!TEכ91` \^)Y;ƛk(K3t{̵| {WCwq:4̈L5:y݁_ޅ0e{ ~+%-kj^(!^x蚋6OK]h\%ÇǦ:ިF6dSy0QVÕ5xG  (ے8}x87Р}B#g, h|)6EAwx32cCtkntЭV<56CnЭ=@DݺInȳZM4]Z_ѭ%NC]5AdJВkCU?ؖHg^ !&؟f5N#tfѧYKDzORqzoI3mG*֞&< #j첂Y;pvL+*l'!2Dea5/B9ޕjBYWd2 /b^*YLbp:R>+GS/B̉M9&m Z B,bNtu{R$`sBZɢ@>fyA7&ÚƢ>XbQcz< d>u+E̘*LA3\a#Mdm-ʾh ٷEU_?tQ< g>< UW;@oogjL פ[gd`W)d>#yqPg=ɮQMǼAs]6Ę#a!0$NRp'`J3x: p&Up2;瀒̧5/j`|H-Ibҳs[0DCA(`%K(!O׈D-O'`gAsoӛ}.EWd1%%v 6];IK,{#|sC.m`rIxOHX*͸xj/y1M01ՙ Bu]\}$Ǹ03r;i^>u75T "23Go|̓GSC1z]~ NLAn3m œ͊OxV3pyo'zd"fўtmyxfł) ZfD[c/(H [0;QuiDRNBnlX]u@mi|jV9?z큮јnjӼ  [C206Fڊt, X yXxǴ]=D꿜X<7@@"1R[0#5h>&rnQ#>^'*&YsDmbH<(ϻ,g&*#5 );MC#58X!rX#5|M5Y7όn_w9 2ָcb m.іhk Ԏ.3rRs!=˹}dSglP;D:'Ѡ`a:M39ܒ`@V09]jzdbnH0qCFz>2̊ܚGFv[Y[3ddNٕ(I䑑D{ȑ<ۡ%NSݮ%@^K+2׻Mi##K@w6L 2omhb?^؃D(ӑ#R3Zgƈ5H(:|1Øpa,ȄuՔCu:'icbc~'IiiZ }֠')W"~ڜGanJB}q1ںQ1E|9+>得J%M/z{'DnZcT(vFCi8~D=%]x!coL m<2| QLEp>Ή+ ,u$CQҗ<5 p bmA!;y _ )^0|ho5Q/A endstream endobj 198 0 obj <> stream xZ[o~G9 hѠ F v; fICT#\fo_>\<B`ILPSݥ=msi۲C>w9H7+uQsrumFNsymm_ck/bfǨ+$~8s卩 aNB߾}c|ؠ,e%R` 6^@$W.,KNevբD9DB˼XE 1 [eIZ54SߛiDSȪtn2Z 5kwY+] K ,LBE|uT6R:*I֛#Tȳ)iBԉ-d䂭&#|rLmHM&5BFk7dYuYy S2WV8Aq;һ#|8ͩ_2}_[B0SnZ S%N$`q i*N$J'N}6,NUkM_+Nܩ8#\Tuc#p< p 'dnLnB6N'vn+_kLnUcUͫ#y@jdA7c99`Ƿ93tPR "jw$ `6 3j"ja t/ SZ9ԲX-FBOtF@Z QѻjӕZ2|C%lN4lq)B&pajW"&@BJO˅H 5,2IMs#U.)Zt9 fZ+6ӢCȧwǯo7 (Oװ̦ysz实]D a}g;8#уqRMᪿ_&c2A/ -5ݶd:`?SzIS^8lHAr;ڒāKaWdvJQxOf|-5ٴ=T,Zf=5M5 @&hb#h1;E: A;Z@VٯG]QNO؜-b [yCM70,4B#|ip0ɺ5((W I 4]!㊻`2D\W4pyj3APqrUmnT[ڬKSwbb,:|+ M-KC,RZ hQ-}6sfmu7Yd~}na)=V $qM*J&UNƄ˒2,:D{VbӀ6rN jԆ'J #P}Riy4?RX GiQE@i[NG̞SOٿp+y i̹ك5)axeKն]=A\/fW=ބW=ї/W=_.Ǒڷ,CWܬSxY䑀CM#!<k=0ZK rhAÞ Ndeϰ?Dywa=Vh'O=>o-*U9}B1¯6yuhYSLdRq9GԜy `t#4;)#] wn8KV Pi>ȉs(7^d R6\"Wԛ'F8% g+ 5G wwv5Mɞ S懹^mPTV~2`bn~fJn7ud}$kc~Au!w;VZtgf9ױ[QgÛRdA$chK65BWW)?Z 6ӆ <̔ՎԵMUpK8`K)\=7F?W] Fc֐n߁*I5m"t"6ohe!]Ҧ)b, [X?؂B/}R!|i \{ sNﭏD!Yxzyv@H%"~*O4G4?4P2~{l+u $]ܲ06AZo\PKUu'$o0R_)xC!& [ _̡TS ʤs_M Ņ2 j6T@ Cx8`JHtka̱Yψ\TϪ`z>Vb;8t%_-<(I(堚/#k(t腛vE3:x->}U$IUWQjk*$׾nFݜzN|uF؁U{Q<{ë6ش涜3gD^`LGoT/Z@~u\ش*z၄qeC )-̌hޟ"1z8-N\.n5<`r^O @NIӦJ\뇎z!2bkj^pl@ endstream endobj 199 0 obj <> stream x\[7~7?sNJw0,^``k،g`ɿ*MRQ83sZUR]*U}?w7~㧧wϟ>?=>=5o^No~~N bd? vH勷L$(NFgD#tL:dk3e5?YxNJ] {{;}fs`/)TduelDd-35dvզF,49L [i v Dtr*4c$?Y+O_>|7IyJUd>I++wb/מ`/3\$$VP)ȉӛo-&ی^$w݉eMHJ˓Qn: f; j9r㖙ZםЦ\ѰN<QM?K$S }!*2ZzIo‹A;|57-8BAy;H-4sCv5/Z$ʝzQ%RTNZi&;Hy4,fzԕw `A0:us\B(j(q-+b{1{+'"e1Oc*bb)حBv 6-f[4?k: - FNhC}#$haQKl{B70n(Nn'ft.ڐ7ӅZ%A.3hڜwA1>Ӂֻ}~AߑkYsz %>6 !T>,NT4jXrI0Gn\y ;rFg1V?0b{ِ;R;YE^^c+6 iز֫'ewm&towQ=8-dEqH ;1J'냸3 g P#;dLɚc3,9>O鵧'ՀYў9J)ߣMɡuB=J)(uG!IY/>:4u--J^jS8*-H|.1mLV'QYv  P m4d(E;,2^lxP١zTsR@knٮR5U6]XTl+FȎ}V Oru>NT$yr̘PVƈ"Si9kDDC'_=K@MAQb=O΋<s8 0I4%QqAJPlEYX"`,,,)sNda۰ <$ wa’^wWSLhnW.B[X@̓wJ)&f*1z-Pz]PRʘxp'g'*n\ Rhmx#JYY&icVf exzeib y{o+JVɺc%垐)&LSMJ&(&8g]A617peya:^1tb+K'&Y Q:).ֱf/LϚRDvBqIӸ ɏKcľ ZӣOa[r-oӓ @ז)Y&pq-7c*6CEJ4l ǚDY>)Z!Rj,_AC[}WZ㝣8V+yR",>=KRs_9uD*$gPqJyosݿu < `E&|g5 h^6̈́G7zyu7]Dyڑ$?j"0m4! pp *h 4D (ޠqI0KS&q7=6]{sBàSW_rp\b7+oV[},4 5z5&Єq)5  T|ocmi)q7GK{p!Sp4,ҴhǴ^%D|޳T%RXHs~rEܨ-dg߿KLL&ǪQoc}alݭ%7LNFUb݌ڗJ FI8hSen'#᭎aTi1/" w.ϋp@T˓*S雴1bpYG{}̍g~N%Uddq R^ψ~t~TDž3xkV* ɸ0#"0XAф"m2 Y5znM[]m,)E +F*Rpmcv\ٕL)daɭ2.aQrA|CEX4kT+# Wjd |\-'ԌW癁X?_x1(ޙI84t|ȧ MvkK}YㄈaڈsZ4w9"3fu82K _, Aί t\? {_4`7ApXdI J&O3 ɲMmb;0Qp}>$h%*Aw;1s#*}p{ܢ ˻?_.)D VHDwDY|,_VrVM*q$$j"\S"\x|~%FXh;3T-I  묈WTDYmIԜIFc2[z WE '""ʊ_S<]-]3:biGn"xGdlJ2zcKEXĹfq:@Ao zJ TstKG(Kb,BU)bkwKZH?kq\9~lAZ[|bx>mc&7]Y:)֗J7It**/X0}n~QP8iL9|cvnqZ0_1YТVJ;Va:~4N9iKAP҄wzҵ)^}'o> stream x}[.q2Dxp `_3HQ#c{96 YU$d}`::_uUoOᷧ/_~|_O?//_O?=>7?~?}~RPk~oQO>~(if붜ʾMż7{]xUf?~~Msfιa3~߾:.u}l{vNoV-y{e:cO+;czcUjZCo~-\}]r/9M}zy$bXg}VXISbh67~ؾcگo:>?s\/f և8 u˯=M.mufv*gO?_~=泽g[>%hr2w+HJo~O_+We5 9[%zU?)i-0^{hI[`Es.X Σloʼv25U{qnk"ݞV94c?'@Aݘ=t]J)?tǹeOw݌mlf=Bm:~VGw1^X*n"\nJ[^ B.g'21f"aiUíIEU[ h1~ ԥ#",q0+YbZF,sE~f<y-=v4Cdm]mʼ:?71=jvckv!\=x;^%ܹ']2^M%Ynl7 2-pz:"5qN~#8{u ~>W }8!$ e lTIٜS(r{䌰Չ8*"D,=ܑq3}pE,8{_2(s>VOg357J+r ŏ2cho[?׮r~˪~[/=\j9_] ߪp.yyVί55{iaq 2wkή;jAb2`ƙ-R'RSrwZHlCB˯ѬSd==ZD*E^kMMEm+fDTe.=щ]m޹pw\3tJ- d0⧦0YB+u THD"ԔBニ2?E˶T`_T@'cDݛ F ͉!ćO$Mtp+MٸJ.&dQ҄;A^>U @=<z. H:]A֒}ԽxLHNܪ4D ]XsMn{@x4Ipn˕vV/JO{|7 nOnX %?5a!ȋ@n${8yY8X[%vq<GY&Ai hD3W%07q }Hd9 ":#&rvƳ AS X4&UF_>e5r 0cm{wUGl%/d B)a_99!S \j4de9)QvTayBC|Rz07VZZ;Oxt'$fn5IzB>dV6{r9_k{OYV{oVw 4V]d覚.B-O47r=/}W&y? sсH*iԂDrFG5:4:複yFg5!k0Զ6NXSHsNjB ѯl(44z))ia 낝;J\nV=W~DBt:{ =ՄB+kc5d!}LƮ{n n(кғ(,r:= pIu6-]<34{kփK25tQؾnq7~_!:5 y,tt0[^$$u$W y:ٮl(ף.t>9؈"9ԑo Yyjڃ]` |SFW`FWYBv=QGn"܆ި A=MJ ,(!^  qnS.)EW"+!\#'?c5r."wSnrotrB>~hM)+]SfC, ZH6!Cڶ YH0##̦s"zB'Z?c5q.:d i {hz$hIt[lvɏ'<]BnО+W0M\,G+;]zRVb;?g `AFɝCX6\t jOꛭ_esi7 sܒ±AG5{:1Ǥay=f5!kԶ6{LXqSsNjB l(4q)H{ia!ky #:']d]ˣ؜D<9[@HEMFcF+r1 p1(c,nxRH/7Ɣ5[Jn:b-6)HX(,ӫC&\^*"!YrbFҝPt]5{`cmר"~mezpllTG)p77h1A&״ƃr:6Lo;ti6@yF]H 8>SGk[OX8E¶@Ƴ?2E(W\iF`FõX n!لIcКgb%kbSfC, 6!Cʳ YH0vR##lK ,ר X qBZZtcBK@Wua)X5 M._" uL7{:d^)ڮQ1 r3i!,gTO:K=@G&ffkWj rt'_:8 ա:&= u{1)2zx֦IKQJA)9ф1jd$NMO0259_Ut: 7ʑC$"C$,R s&-'=ZDJzVS$N9MMQg2 j7гQJXX)d9ф =emz;/el<ܝ]"mviiNJ;JBGce EnVCo ICol^̚7˕v}ܾ*\,W/\Ƚvhۃm Ymn2!Q!{jּʉ2~] ?8a6rX:qxSΈSztqLr5kƈW>akÎ#>k F]Hkɠ@KYZ8`LJR~\n8kWb)EW,d-2p-9W,\X&FWHˆ= dćִbۮ12b9A* r]2EFakYZ^kYzj\bM4둠u+Upk-A,U- Zq d- WH@KƯ**krzG=`9ԋl!cTObύhܭ$R5>l rD{-:o )<>7i5ETs&壔pvSN% \6P 4/:>8>7SskN'J;Jq2؅H}Ճ2'g `=z)_{8>d|.b5<)saʚ |VsubE쟞zK̮{/$]?Eeaw=n?3.flr R L M ߼o~lWaJ,o9l,ͩ)rX:P΄rN? &\͜2BrGr. "sچ J 18=TB2LԢU9E.V4ʤcaG!쎬h v!aaszuVl!P!¶t0#=3CڣGڃLt𤌴&w͛Iee' ZlIeR>:PŚe2Q2Ս*Z|_ Q73o!2Q!Aa׼9"~]T ƪց'nu$ݛwҝ{˴J >nmYК\#+ REsƲց;nCdqo$+.2ɖ5}|JU\uغ@?2Eb52\YZ8$rz+r!SpX:M8(\t.V_ٓ,\\Y⚷]#'\0b9 ҳ]2EF~taekq_sxUȭ8Nĺց m4w\-47%ƵVXC+VB-`9WHB,ӥ$/%y۵sm1 ,VbnK)cqDOEIkl2*=n@P? e|RlemPQ Gex1a(c#YMM&2fD RƜSD2E#TݑU.D29oN- ".f1 2F2eL O )Ƙfٺ~'u;>:Xî{wdKOu 4 {z$|z/wb]suz[Y l۽us"ԀvdM ܭBrk|n-Vd-v9u" Jq鋭¬|ĐT[8NudBi G+̪4põW*Y˭B gp ]" +Yi{Xem *B, WnB xܣBk|bgb0 |ŪC걏X:|nD:U56Ni709Ɯp|nG=B>Մ4 P|.ib\6JٱN!9E \.PͣS BZ|n熑#M%Y%8B$ B8=B*=_ssIsQ:UxR:Ynߺߘz h{u;>:Qé}ЯnGl-K&7 0.Ɏn ޼]zOd&4.OXF7m&nlrl@eXb#d}6٥$+lr .Q l$T$ 펺\X%ZDrMr=-q)eb!5276yU\8#چ dgb%=5$ 4O@w䕄@2@Y`X=LWHG6zIw _b\3J5;e3!<(-P'xBE'+ѭap]c_2ؽ"VCŬ'֣1_~Jt-mkb8%wF8=û> hz}޼>ߥBb簸^E,i܆TLrtXVi_3'~[UهtQZʚ#@y ; SXf oOPH3vqSNGQD9;O-g y9UnAJKYL{`@6΀ TpsBP{KqҝzpLloX˯ Dh"ݷ൬=`=?}&{R䓹^TtAu@d^~KQ}$'@/x ў=~?10$(9i_i ثce=p|IƎZ`,>d7D| z'dvkmn#*z&N7004޷ˎ/T.߫춲٥nv˷W)߳$u,6.wt(Vߛ= sm5NEM2Cە"3],M>bv{Y|LuA96PbB* Nj!e齃i@dR+\{{7}Z# 6/Ty:PWeQ/LyUs O*8ïm)b4fէB8R*:k8KQ[}_6Dt!TrY 5L. \䲢v.xMb5Q(j[35q,>J`\e5XMbEyq\V)F.+Sew7?rE37!m5#y5X!G$t5.=ՄB+kc5TZt{fDVZw(P8gt;IL蜫.:^8 ٲS|6ZUp[ ۡº{#^k5nuϒ2mz RYa.R~g΂\si[ukҌQVZmf~*uf$gFY3TlQekzn`k'͚Ir\^ԭP ZPk/+}Qe";.u+W{gHAR9~?ܑ<)+ߣU;[8}+wԆ~o;9n}+4.%9quY.ijV.)"kvԮN,\Jw]\mײcF̆`ρ~+{s̏41G1^le&hX^Rb1eKlNb1kFRogb iu>շ0)LdOtah1e!(y!!6*הVW$as}~}֌aK~̣{V2I\_bm2ajy& ިc.y^lH/c%b9vj/C]42}&dm"d++j X{Î|Kt C;rE%[A'c9Ws1m8\ B!1v%1Xzp,r2t4w2e#nBbh}q_`3xfBݚi\ە_/򸅂`3h^V>]VMWHPl%_YAeK? ])6Vi0]DN1`;zx>JAO?6u 9[ vkY 9Ht(䨆TBfbV1SpQ|\HlB+,( X@Nҝ.Ap ]".Gִ5vBFlModMXNAF mBgLQt )LXQxm qB)Z Z W >\YZTZo R VZXLdB=„ ّ\3Gb5aׄTV3gqʭW|[݋oMڿ/{f ZMg^:MVHLߎl<5ɼm]}y#w{XS]߸ ev̽H&xIc؏ugchEʿnySmCo~Νg { rSE-+-\<ڗ%?y Fa9̛}^}(7η"ǷS.:f0fKNwB xNc{hhm (l wguy0v?}xaofΏ9w<֮9?{Jb8G`: ,Zïp>"̹ u9֓\w'./x۵X}KVM3z8 Vs2]sݲknׯ̙mPdrۖ_s8u.+!'#񥿤`$C@0&}0Lܸ]so^ܛhzn-oײfܫ/t>/'p~.o||zSO뷩/ViWKמ+e_Wsz< endstream endobj 201 0 obj <> stream x][$7~oPa;[Pe샙㵽~{lR*SR9nWE]ЧK:ݧ/o?~ۯ?.O8ӗ޿$9&O_;L{aR@b7~Wς7`&Zƌ3vQ,I'rq}|77kk֓gɜ9A4؛bgsF,\.vҺT씩;#ӌٓrjd%?wӯyJMd>I+'wbI~w߾wzo_V ܑ &#%1}wXyqef#V_I\vbRzd pgB1!jbHy%& M fN]M2~Ҁ|rYA+CIdIE9XL#43^ AؽxEn쎆ݸ+/1y\ 9`zg?x\q{w7.)3f0yG?qqd.˙Iǽ.S?cAkJG#`$;X%%%%I}+iyCIII=$;YX}8]ʱb ^C'#Q*Xٰs@X. &F j£n:j+y.I u*SpT/" x{vM,D]}n*Il/>_>}׏1N|ŁJ cg-eW8/EjEgt N ;NM?X;V;BtYTnx'ۈ7l;E07oH:lj*q%j58`DPK/U_.+!pg\&%[utݞmdpҤkv Sr=YHP˺bR#?rѳpuG;~v'!E+Vnn,Yjg\4fF08Zд!YEw8c?ƹ u^p3B_ح,A|dž.ƑbvrL W9h]{˼X{2jO.|Ԟ\F?\Ϟ4C+S 3[3z岷Y볰)7ش[rٲ*j-Ȁ|gg 1b>0 Y7N~!-gj2ׯ~1!J81jԸB_93V~oϘ1 'RO}q ֗Vw8%3ΣP1ŕ1C8zotu{(_MC$;l251(282mp}@3%:ȪL9[2*p`Yв,ٱLC32Yf02x24[ f3Ff08;7JJ5䃙KXpaEl}{88Ɓp/&Y!\hf2je$+p>0aXčLP}ϲ¹Y@ 4-fh]v7/5Z͵ JbP t5"q6;} (W╰?G<Oa+feBm`#jfČ}w oyz-M#?.fMP3" :o=.oH7*Pt1s]2 +@X^cBYu8gǹ{MPwꋙyu~yH5bdfQW\ lx:;?nM)͔x!LDži?qe;..:w/jZ@PU9cfw$[ 7gv3ݯwWA PX¯::Tb(b fv%,mϩ:0 H >7'R̺D5H { <,G V 7Ď$9tസ,ZHۈKyL|}dҴtF$#8-Q sMV$m{R|/,8Tb(b%}S~E&3%pvUb"l5$nZ>} t! N*kI CIo&$xlmŘ-H[38X|1} 6ygZI{z6h̠ZjJ7 Ri PMY#Ytʰ5HۜړTjJP/{K)`yD"A (_|FZ13Hv%ขvl Bb?.Će:i6ΊtrBHWLʁ~g$3`I5U+(Yv] -:Rug>\'Jx)C eE˅JE4Jfe Q-jħ-X x\WRWc.~7b}}R;cz0tjI-<@jV(x%B9dJ"WIV6V9\nfDTe`fA6rEgY:EW8ПS^ j/*Kj$5սf )7Jq h:ݘcVRoU#J1 !+̢Sj[Fq!hc^c;˭-EKJ =雸FXNk5;b\恥}b f JO=X б.JPz/!N`܁ M-)5>RQUhEZK:w:T@UH#my>lV3H0@'c1,%t2Am =DSgO-hlKv`̂<4 &ੁ -cEExjdԂ(ɶvʀFO 6Ye*"اw@Y7 A%M>&&MpB]1)N*e*;}* 84Яی7_MZoaE ǎ dEWl .%$e%ʿ5RwPtWl߷t}6Bt)hP@Bޯ]+7fɰ a#[H\ndZ @ր8]m:"<+ Qx.( | H_#Uf(kv$FO Gzbkw>n8{‹!^"E1@m%"ڕl{pۯ"?9"@zUL/Ct5QgFWˈt,yiX  f"ja=REbn@Eb-bOoKn& x.b :FSa%@DlXp[IN]8JQDR[vCaaZZA|D7 :/!}yݲQ${Kh)2xf%,=Gpp!+=jٶUƿY.x]vY:ZK9A™?0:d4:gQ45Gm S/ȣ4t4"a͑+XkRpxwa:$<3Y<!sI;r%wlHCrcQlj˶ V[У/&ௐyYt});F"C'ezXԷ"`)A͜WEyf 77QfFxHo20Y]ջ90h7)p՜XèAIc> mV!bU(⣿&[^.]nz9cE/P'MObn*[%!QPyytzO~mu q%St./p\A~pc.P47Z\Yffބlv72MĦ R'jXM@ބ pmVi)߄ YPv;smȠ&aIppI\&dєٰ oWjOoW'_,6l jLQ+ A؅3 m-8:S.FXuR XoUQzd ν؝{ : f%CD76*_݀3! < i>4b!.43F.,T X^fC@Ezb7*owtȨg= )ZiY$Jfݿ&rq@;o=XNwvGn~RwrvU2`b;PMnm]Ҙ* M Bo1$-H7p!ݐ3X7zۥ-x ͷb;bz5Q)Rc(7\^a~yK =븺Pi֟lak%5#;%9`|6}ճ%%(Pv(Rv/1ջ#KPHSt*ЛPB+*BoAqzyVw\UsuṱnP/)AF [ih§-.فRmfO#]4рO|R';(kU54 ijçV>mʰBm4dk=H͝.&Wh&׾$1Zrrv3R_4F'Q ޷)4l B7͊4m0TaiPi Ceq%$qiW  endstream endobj 202 0 obj <> stream x]Idwcqgi_1 3`aMneh =!,z =˿_~yן~?/??}/OwO_>^~OB¹}і\9ϟoTPI؛x~+yaw_?;QQk \~}|/ۖGPM{*^7E͛$/)fInJՊ] U}1iUJsGrWvF]W{!WIϟ/~_0k̬Xҫ"h$ubcf֠jϷ IieW#.^)**rqeBO^.i {tqk@%R}ԗ L]"ZF|g:K:$VKW)!?j 4* uQ*.EE0J"[ʀȏlU#Gӡs:%t8:rrx^>Lg HK e 4+RS7禕č+bGߘ\Vk=WsS|“T+ AGHNZ93ֶ )35`T,%كWP%+mH"~>2H6"ă e5p%wo<Ғ<$4g-3NtGo^5x>yMb7}~ eidh%tZ \-OYFQ~1GVz > Iy ?67@kE@F#,U!\2 )O *Ƀ%cjK) ƚd FJaؓVENb!Cѧ8&᫽c6Uw*0<«KAN(RLw tuNЀ0QhQ"A3B<']T0?ƏmJJo<`cP?t;^~?/MϽňFRì>^;hPPZD| f/vEĔAjA$i [3%c | " ւ@@ bΤ#I!Ywf'< !!9 MI($9 I4 M~d.t3 />rZ_ 77e|\Bm0٢ _.fVkXA qUUY7nja4{hnwҷ cb:L-GviR#08L[*Bo0}R ɛ{#DH灎8)* ,pP)`~I;$[S]JY[dR?]V{ $ ={Zѝ6& ,eDM'a # S$W`1AܣN[Jƙ1.t(f/{w/J:4{ ;[ob o+* 0&QZWizul~]=vLZ"6Ѵ1jB<^L6WU[mQ\dHůڧXwfH=iZ9&(Ao] .<|5Jh4Omߡy.?XJ@J4lq2j"'C:k]3~ E!ёjT#%vw}vV}_eU.߫)%LwM @ݤ,M?)tRΖ.t7 τ ,f]f#U3ݘ{OrBkKbY6fs$G]ϱheL3KH0:? s\;wyLǯ,ikK  *L?JjwTWiЇyx{`+3b`03ixBvlCٜizʼncLRaRF#I8eZn6AFRP@v^G$lp䖃(P~Qj 7'Gϲ9K8k9꬯%=X#b6 k`Xe,UER;h-5q'}@fQNOʁẗ aӾ*BI8S<96., Qa_|NA'[bZ{{;%Fߞ pzi_9Ӟ0ص<뫦Ý=#0g;_~Hl;7h5?>ky}.WI_%n {(kӕ^eOe@0W9(5}IDF"ھoE&B::I^B.mPSYwSkr_E\n@9eym)AUIy\u!b ڭU.! &9*Uz*o7rAWid_r ҞiF9l^z7X%\5p65~_UJ@8\T`C4 l"vlXO@IOK&#X%QS}UUsA5JhV*(#3(i2~2> l#[)s {dzTk1a4L+ dD+6f~!5%p&4VM-Eᛈ$\,h蔛[jS春N^ C>C 34 Ɋ0lfUxMfد<ǏP#4KW[5aGǀ"1Z0̙$LP䒃&PYG9Dd~1ƈPsSϪL}Gy#5 -.w772VJա:{u9ʑȈ&Gdm[Z%"c= ظ$T/} ].~l@dml#[X#%KdZ`[ Oo^hX\po._G?c[dr07gx0O݌h6D&`(Ao8s9Mu&yw (ש3q15Ԃ$z-pN4'vSKjH`Ǿ6SyМؑW<]H*$Ѵ\Cshq]xB 0%\: x/F86kܝrw!-(7#y\rbglJ.fn^6 gOK_֕O1Kp/6yg }mB/)+QƥhF.M*x WfA_:EkijU %+QׂUpVCRZ^6A )BvP$P$PـQ6?<+oU{_gn3?%(kN~͌XMK6t1ZCOX"ʪ \(cP\UTs'jܞw}A`' WE57_&T<z5+\y0AN ZskWBgyKnl\oZFr1TY/HWnkUQ%ѭ#aUynaY% <⩐Oב 5!%\r|jٝW-rq5߽~RLΥ/H Ez:{e *6MnƼ=K"r׹  @'y\ ): Dy aXdòQ2h akTH TLB냰Dʫ ع+VbTx>{63i P1$'haAh*QQaR8%i^E *Ed +D2cD ]eZzDj!9791UφW sIfSiEe< z@7\ eWK5kvڡ] AٹƂ!Gȥ-L=`1yw$z _r /H.Wj!6-n?, Z5[(c ƈoM .}T曝CSMQ*n57CVv`ު%ΘjתWӏXŤGu||jtXWۘ{ >i>ƞ>y\1N8D^v\4z$n.@5<aޕ⼎iٶx4Zu] Co/D0ΉXf+kfհ^5t`ΌW0s!cH-tnsۺyՊ Wϫ4#{ ԡ Z+mVnkjl:Q`ҞɎve֚*EK豄veڕlK lȀ[خ6'Xqtj*6E!VnQjW&m$_JJU]Y>#{>+evy (BU{*9`IJ\rK*۔'v#N-KtiSrNP6#42@]?˽b-G}ƍ/j(T9EW V3 4V:t5C\soTK;OvkYgZ#?xu_7r\܃5 zK344蘭mu8/ߙ4z|;& ]ް#"'驛kOE'hx/+VЩBܪsqݜ㤿U]C܀q,6+!*Be4*Ŷx67L_Z5_BCܘsG崿1;hJ,5JGWsxLQss.y!X!l*ذօ)v6VQ^>["(ձZeV8dVoc9n4x4w\S-3) ES9);yvBP9hYf0B3xjSA0L})U fk&AW%N&4 ıq endstream endobj 203 0 obj <> stream x][%q~_`y Xgy'3$ Ev`6x'3aWUźYo_n/.~o???/_|?/_~.O׏qsu%r?˟_!TPI.t?sŸS"ٝ! !x&7f}bEq'rYD>O`>^7T'ːjV]I'ET.3wR"cH谰|aU7Ak-  1w)$O= ߠKQQgdΈZ4ϣk6 4sWc_Ƽ#};~4v;rI+;B~e8kn@F^=? "6M)pIxqNeھgA^l۟w++ex8SYԇ2{XIq+yK,`7:&R荤em9 㩲k5Kɹ`f۩] #:,Y|mwem/YYmAMV ZبgP!uḑ0Scc78T7(޷BKB]9yW. (GbLfd9kR3&^QAAsXubz KCC2GElNѨ([r'piP%rU 6IG:lAЃ~@ޗ5)&nfV]v ZU81!\_.l%y i҄B43FOOP0UL=c;DCnTVG]RBگ>ُ̎#4gn(EhX/"t:4dJ tڸҽoV8,lni}wuٻ; [qXd^ns*J8&Nspy6:I J$.UИh.<4L^ E318z2[ r,m'5EsZwUdJ!XFk LhPxYȫPN6,*=n&v,`Ocx? /nM ܑ;ѷqYp"j^ ~y6+ l2vO~xSnQŠ Re"b&[ؒxhUYeH.h-mKe>R7EF 7&>xBٍD1\w,JHJA~AI1A`T #QFΉ}Kcwl uJ-T=n|$h,#KR'B̆]6uCRyj4M=鳙Svk~̼(jGIZH3b6iAn/ kC(!?H0eb@C>ÍA %e8ˤv$O`>h؄~@d(|+Lv= StSj*:_*.ʽ0"^ň BvDK@]?Tp^"hJ!L4np"p\"6Do8 r@9ESʥ ^tޤj/b:[R6$һї7( q;7%*U;eȦQsH~:"B9(pw'ڌu;D'A/ymF53L.P m+]zmek):쌵5+ +N(N C-$&aTpڣu[֟~~ipC;s~~}"QvND٤u!r5 ). vHo{6Y$XaS"r3rg,eXB oOO%;_~feXeƖ#(贴Lc@m E*B4`|:d[]K }Tthn:ԒiSz=<>VsaPo3<%) < E__a=sā"caS$ ͨ<-yUG|X'NJB)&3ļPi`EZyI+TD \*$z,\!e2-2ևJh2b0>haO)~A'MƸVYørb|nqt)AL-Wp;S\ r+<u yw[%րHe8"( jM7E5DyK _C "∝KYUE?m7ҫP0 yF8cTϭCNmrq*.߃qxGD8Dŗ-_zV+mAΩw`у3 y(`A3S`D#慝"Y)?1:3Eq6XYbp*Iד"[ (MVB |VsopGwnYdkBܭ.AbvLe]2?-Ƈ2qNxZ2-o24ȳᏮG%N*|;eo%q=¤Od.h-dK^ gW \+#蝲WqɞY.͒% &O'Ѫ+%)?}:ߜ\@YVRfBD lwU-S&l-hubd/n\ BSpaJ"U0k^o+;б^C ?̦7.f6g95lVjj-lZ8c (œ3DtZwZ\BPC ZDhadd-Xqy)8q?+ hHD .Tcy\C x.b@03D è %!n{ AU!y;Gc*W`l<'AWlU@"XJ ]E9a f^(T"X|B;z*|BxV, RƇ\Θ2&m[0Bi @ײGi.O'ZS 37 PNQWUvR;A-^t {>FBqJ[&V{CYmܜ|n-tە۽}cI7m Y59-$n2cEITw~Hl)= n(ND/v :q{(4ͥ,1z4kYYM / S-+'yr:c 0$[g9}1ʩkg΃|mk6Gmb P!N\*ށǝzKܩp T)kqjNa^pV3 OLB5z)p kL'\,pV-3YtV=Tf!G87<~8Ҹn 3?k#Lڀ4HUMW6Py=V>DV`H *I z \U.UT.{X=hbe_M1ZSA fkZ-ɜ1R1 F*,Z|AB^.Y(U1 |B+RJ"[A7DI $kA,kqq59s#BL|YCWhN<~Sf^1n}Ox6߽\f B.3wFR7ȵ2FfUKs͒N $@_FvHwHy 4 _C# "_G1mb5FzuIF..r:8m;KqzeM8JKb_[V( ,5yhZfBXtCBx9Z1`7*fl@@gx{)By-VA;jB9rTl[6Ą~]]k jقhHDSԔOuR jTT2.{Q<脣(CR?L>z BQO@*-)ߑ<'|:>SwQ(54[I5dA P jҜBdN؂Bق#' jx"4_PP*ᗞ _PP*Aq!5 |BS$B p4F8ML㵬i8Mp** ܅?|(g{u}0&Z,;uno}QgT=7媞oZB1qx\;* =B\|t-$h5  W8H TUGpF?8#/g ;#p,VY ^]Up #8A@@N, WVZ|r,蕥ձ|E'䌵(sRuk5%p .{`A\8'05ΩQz} k8DkCP澮m }\®+ˋ/؋ܔx>VgC抓:MU*A6})qǏ#eN4:%֥=ظꄭ:Y N3 qPן|A4;eUUHzV(X+T…GZ\G1,kѤX, ;/#aHpVJ}S6{q []Gr=gUj3n";d{~T6_ՐV5@7ԄGH@E lp .{T?&&cq>w?V7Tt四H@% lp *yT?dM$nXNM*(%ЌM1bIʃu5eeQĩ:xaXM! R/ K.j"uyTGRe# .7uPgdߺC*;ju TAQ:r(#RƇ& D[A0 i74,p |j\Kݤb2M$XUll[o-<+pL<u*\~}Slslp{RfOAtf3[inOI^OO 7don4A}+G"Nz}`e+S _ᑅ<Url>I=݇+c<{3gJG,5ǛE2/~-Ŭ$A=&e޾>ePfc%G@np Umkf8e6wG4E2=? P$W`vE2.{P$?f@"yj;(ϛ"7r.r;]JMvEBH!g'16q2!dJ*t9s& f FP*'"74|^(ѯ@O>/x6PG.&17^ > stream x][e7r~o_CZ } y0`3CGkI{M`09>VU$}*Ւ>ןo?~O_O_믿r._޿'}w?Dؐ}FG*q\oQ~Q̄ؤ*x|ٙ!-'f7Ս<\T1N&D)So&ߠ i:q7FN zp-󍜤'ئOh?wO^~@>Lm5x9$$N_~f/7:M Xޘ`&X6b~=}Pqžgڌmcѝ1'gˆDgra3~FƑ:TBauJf3*q@ym1Υ/i wׁLN{ 64p`Bm$ٻ,C]l$L4)R1W$X : dä"B%ቇ P 2$G7-*ipCjj+R> daIը-J9BU[1IBLFd"16C|,ㇲ]EVH\TQSضTD1`&ȩ[@Aqѓ )S3)VfqYV f$㱍5\`"]^{3"i.`~\)F9d4X6r䪓LnmbƗ=[X.cu\5lPdPG+2Goi 2 7j4 "Ekȳ@}J$hD@6ҟ~9}o?>f0ʕ%ve] m!x\:nG& #4 l¨Е% ʭ1ٚF #o7k2Xi+@8s#[*ݏ"LeM;O [bsg(a2B[3Q~p779K1gfCБ!J`p=ä XhFH+`]FtH ouT#\as"鹙+}٥ѭI*rQi 2$0~h!2{ӑ9uÄ^OF6WI{mSxA`673L ̼M8Am΅rcaR=r*cJ=2*aBQ@1Nq@6%r'S\ʘAL$Fq+b"%0ʣH=k,X㩋v$c%\(w X%K0wNT-i_a8PVp ' i;{L&#wyɉ#œ} 3J" ,iV#;Y;Hb\Cftؽ/7(?LhKkb+E󘜧ߙ@"Pd32~& ]_\m?6oGثZ\iBLɺ' mE%/m%7#iil;[{ cWr0,3"y=/&=Sȍ\Jq1f2IG YNDQF@vRRt d(UCLbERFj"r U䓧Gж*URB4M{d:PfRmrVC+6S"bϜMFRL *j(a;:Pd:I h&1Ɏ j*8e;'J drbjGM]S%ܙR Ig 3:Nl]Nm]BzRiy2$^E@*>"/B.FP)Ǹp\A;E=|*Mw1هfuWx)HM`_7Ù]9-O8X2$Fi\Nan  *,:&yqm3+άd?0)Z;Y?-ΚLx鑰j>\>)> 50F_rW1kVlm襃b1KoS­ըdvk^#DWk  O1%v60&Db5(utLvd҃Do[?iilVvހNIF$̵MuyGAf"U!M(;,QnBG'|3fffKhXԏ"T%ϼX*z0xNMЕҢT|Wj#"#TGT&2K?2 3o^J1n$ǍeFIPn:6JQ(N%DB3dgȌ 0C*6DHXY*I+ew lddzD:C4QD'm0d#% 27cu. wɫXBRJ=3GX*GOq 9z P'V>]G!Yg*t>jZ-| ?B&#2E ד;) U6bL(LhJ"kf,0+ l"⤤rf,Nbw0MlDN4P}#Z./Bq\eہu i5anDD\Yj ʑ=vנjd(߁g6?+,/\|֩sy|ެS3Ûb<;=~{֘SL}@43qUfũUs_qN9Ӄ՜|)ThNCCwG7VAzPhCmذS ?,<ž@ꢂMoV(_ u*BO50+:$NtZ;xfA4QD3Zy<=_ 17VvnEÐ FT3q+F Cřl4DFB ɟLpYy(0vv|ehj-}̡ frAcdUw6PVSM0< 4"ht>l3;7|DD oZB~D vM8<)ݹCX=v)&qrYL<`T9A,C b!UC4VK7R3H4dx~a'bjA'"Fi|v iq"Ky3X6":=^58XV6tz"phxs{3=.N.cU-"<El &(fQUD"12a i; zZ_!a 5gyvs\b ή ߢD28=ktvsS#vLtS2TdGAr(> dἌX3ƫqc<*U)͎R1/ӌ(\{PøVɁ.afA6xe $Eyy |v UN[Փ=3J-(``% Uh`| EXćCG8 JB!CUBB)KN‘_[_rƑm h2Ph2c@ &&' 4sФ3eJ;;$b@t"D9Gl.JMq{yGQ >Ai;ˀPp7~2R/|#X YêOٓJh ,)/b'80KGʈ=q$SWQUH'kq2DQh4&Jp,>$QF&&u$ }ZU%i-evaE:^5~:*QOC){2AhFCCFjHXñh,Nĝ5ŢEA[c'VA)&ig&O5M0<4"h @Д8;0&ܦvtphb p wSpD>:+7A\="#Pm0 ՕŘ;dVJs[ ^ Gު̲!]L2RI*Z J,x[ˆREKsjt(4xU 32ov"0xUGBvNc=X[鴦XHǢt)9@bo(R/PIXڬ *$OU6)RI2TX*90$T:eU i;MHv.g(upe&DkΧUH^n'2$F7C^WƷF6HdZ򪎟OFh2΁iRꀶyqj9GBY'4`eL /b3K3"rVz>JkD԰**b^KUbl(lm\  J,Eu_|:ym Bg7Tp,Tf{,,dD[a6n/ :ekEQJp el`6a[ۄUnvNpt]i'G&fA4QDAŅڰ(k7A bQ0o)ƳaV',ke+'XJhk]20ɴA++ Azx%jCg…p: )յdʆFcЫ+*1YFNB]^H\HHNC=QLT,/U{WDO </"^Tx!B'm6&6 '6+C,Ui fd> stream xYKo7 أ>E$Is63!)|zx(My8<|~sow<=_Ix19x)c w޴M;YaBa ` 0L!X{. {,B7d:zuk`Bx\p:z<2LIc1|JQE͑j ;SsXQWB r% ;evDF40gc| @DɤˆU&8q/3OZu:Gip~uPL@f C6/+5TfV;F1s>!QQvF8u!j!.8`K@QgqۙwTdD=@hߎY! 1/vM0#R#*{č9Cɫ#~)R.HZLmm{)5~R b^dS5( [+m 64.L,RV D}G{5}%4HV'TD؛A`U6]SW88P o_ ) zD*fݓJAπ|ңz~ /qvɐO9;+3l/fxyxgRKrA@C]hgGv97Y-(<:(,$NƜ29'd:6uZzݒQSDt~lfo5K4hK3<p2ӻğ9{@sdD| D [T0J&nysKYT3AH"3H.fwEլUs`y5e|=e՜8j˪y䌥լUbEjTWvsC, endstream endobj 206 0 obj <> stream xUKk@ hٝ}0Hڤ4PL&ub'AP𥉉R݃4ceKpm ϳiV?a՛ʮeYP :M ]`#P`= %~L)M9Ĥ1PB-rWXH7KP[89c6B}DNgfS;xqa!e6FX׫$\Xآ%,QbZ9aLQyP7ׂ%8%wi-$Xg (4N8 i6c=|c,}dIXqD ]Խ#UvY};-!-9(I *z[Ɉ+Rʕr1^u֐jyㅶiGClvgx B; }\tX6]#=LVoӞufw# q^9ríHQGZiG~.g9%eXi+=vbGhː{XcNQ'|CNNqÏARp(]._wnRE9A8 q U<&h\Ḟ߫ Sq endstream endobj 207 0 obj <> stream x]%P ͙L2?U]݆ /`/YuJwf$)hɗd< f?񷗟~돿?__?׿_޿w?~__wpo|~y ˺^~^r_ןi~qeϿ}f>} ú^߾ ¹[iZ~}a4|^?_wey[qz}}=ޗq{HlV5oeI{R&? a_a{1mrOoxp/붼L_ &߽|//?V|o?$ 9cc+#Ұ_?֊Lt}#+L_#H2Ώ}IZp~ v4//ntg89yۛ}!t^_놣8r1r1n/済z /a<~z_/]6mm:+ b: ҡ'Η 4Wgykc;.&v ٟ;6o-|i̕Fv8v 4ĸZC)Th[c|{{4 ͭܿ,cZij?H&2c66?֢+FGKt{Jrcd 4:hBV~݀&:AWŰȿ\08qT^T 2 =YBI낝(wU؆eㆺzerLޜc!EqG8NR nsu⹝9\wLw)۾.5o΅38 n܎zY_I%Mr128:u=kۉ9?h棙4炥.5"~Nw9ߧo6/тҽ+d;;!c}{e~/ڊm͹9,SgcL43Eآx}>&WgQg]*|kJS_-I}Xӱv8Q=Տ Q;>c%=ur֯_5՞Ǔ@Mruk~E si+J*)?"#~.x >ԜG_Rtx4y޳0xnx?s 76r3q8->NnSS4VtC:YO-3[y@ml。dy@Aˊ#jdXLih΃Q/DiǶG["3YK~^ ,JҨ_ {z_^Qc뭼|iEJ}u>2'Tܞ oM5,kb.<o0׶LVs]?0׶Voq>=~\†^2~n|hΝ͛dQlqF:\S?OCiXF1uXYcW4 (C 0/udhkԞ\=ʅ&v9OcڧFR81 56 r7kTLLy~^ ?߫IqO>}/?T>Ο't_Ľ#HH4g!i9q|GKˍzǩ#tO{߱'b,&gaw{\gU?>?f}M+HMkH^Px *yA$lq)P>!6/5T1Ȗ{ڸaix_T` w7",,{P0onqƛӖ? :!^w֪Mo߮iv۩chJ\hgYӷoWI֩#P"5zoJ>>5Gx: VTԧr_Xi)=gLfuYjKZeD lipe*7upo?WKIcYC.|]ŠNϟPv",g i#Xm?~O6LFCOoh:e BwÀpirBl'w6-|Iӯc)5 <ZKph*8~^v֫?P.zo|z,˼ '; {=m 2zPc EoLU4 ?>u= ކ\A3mՖyUoxz xV%;;aؔkh hyˏs3uweuJg(3:UX:o;MP yv@;xނ.P;8.4__Ɗ1τŶ|xO;h=}N'\tDGpimPwwagUx=ف<-hV "'t.3@h q n?K&P0z"h~߭TT5m'w˞".n9ɟT.$$bRQS'2Ah$ SP;`}VX7,F؇躞u /z"MEO$hDB xmsW6Tfpi;9Fհ~Y8U;7);M7>Kwh`㳶rn\/7 r[j8bn$l2Ⱥ.#n2&,2Z$-2{8ш$1;/\UrF9$_8it9'C9sEyr5*d^k" HX,Qb![oo@%!LTh>[U6;,j1T$㬖+aFmm8r%G[b;vRE55{kj~,I>IT>|!s~ a\)v?TSXǰCAm@yirأZRk Tfu:$ɕ:2g 7ܼ5bvcQ 0522j%_kEWЕ+S1I~cwAؖ}|iL^$`[ [#[ [ #$EE HVJ(mI$ 9EI"rRDl"'$EV -X)V<0rWkd=n}9u`pw݇mK4!!%?TlX D{K$LKyi&,3Ѭp+sK/VĴrvڈ2_1>ۘ C0,n^|l(gQ3Od1aVǚҙjVScVBwd |8kwzwzBBz޿hC`gg}P]ᡆZ>xvBZ1*_ l4A%_61v&c/'C%jE[Uk9{|lBM%޿1.a*KHA{Tl>il]0į`'`fcbZgB;vˆV ͎#Z|06="ravQcwaTjr,rcr 12b O$2GfS&BUj%84ՀeXb0vbؖ] cwc7ُ%7E7^cF#al)C'cK"Z)' cIƖЧalS'``lø#!Y2[7X:Y0@$J61$?䇴J 505q*bTmB1X D1M[ܞQ9}9;xyܷomRU1 FUqEUn+VU.ud>o{ӵ٨XD~VD/}QӸ!.p{  Z]đ.nni 9gD)_z) kn~itCKDwCؒ}zMgZVPi "Zʱ CL{Xl.Lh23/rC`hfbBg)UuVtXxQ=sIkfjՄ"撪j 9E;.4N"D+%a=!)B$Oh* ڴF(\q+豂c' ^i,AE?UmX.WPi6ǧ7M`بVDIwܮ LoN6v~iLhmwG,V#D):w#Rӵ+Q)h3>~7o|" nd"nӸ=9=^XE#C/C{lzQ?K`zǯq'}> Ϊz77RkżO)n§}r)ZN-9*d^sxS4Ϻ`H8UROzy9DۜZ \"r˜B;ŏAYU6;,jW9)fbCD;l'M&;kj)JXֳ|8H1e(uK~NK)n,>Iqb| gM"Ūbꃏ)n_K,KC@Ԣ鄈gu:$ĩɕ:Hn^KBJ{!)P+=*6cZunj% żn>j+ukH9v+}lm''@g R2) )~XtXvtH|Q*DR,&qRK$Ţ 9Ec\["JRHŤ"($X H1ZɤX<0żغɂA7ԋyE?䇴J 505qA"b1/Hż`ccrl񛶂V$J8]m4NniI=,V#R):2lW! m6*IqA?)68KJjwRՋz/BRđ/mEqI!L Fv{5;߬H1g<"MSx|DS bKvŇgxC© z2T@[||D;GڱO.^xV ©͎#Z@Y-Cc|bD;&h#2{bMԏa=jArj}|DDC*HgM"Ūb}? 'b,KC]} QUH XHqZc.={Tl.@ ΪZD7UGb? j}|$D;_۲O2O"RA|z1Zȏ})f?K$ŢsU/Hŋ ޠ>XL(B}bSA{zb). I)=)yBR Vc˃N)`@_~N,kF)RC*I6RaDϧv5d y;DMSAOͩaER엳Ə}x_}Es iI=/dbMԑ]x۠+Q)L3ػ}w=i )0bܩiIq_/NEH^8{zQ0pHw{!)ϧ﹫G|jp#ŜVS=wmSs'.>{]CTl>nC© zҫTe=wb)+]CTh>n﹫ASSGn j5~sgn8"rM{Qn﹫AXS+cYN 5~sg_M),]CX$}sWUHXǰnk_{}"rk KtHS+udk5ﹳv=w،}jsWW親VPS{𫶚b?﹓cHqb{b[Ix`PHH1HIIxQ ؏D'K9F,yHb))bRDEO eOHJ!Aq' /V?N 5l#K~Hqi)!$j~)VajLlj5d cIsG4%}ϝV$ǯ-&^7m~q)PٜȦ;JxRŪjD5RG)A9]˔8ν&/2qg}6 T.YUđE>.FEJ"_vȇsx6~5;풏!dGPjpóV\٦ysAgSbK(Pƺ`UROzi3gZRk{&*c\eAXQSG YVPh@϶i%(AxVS+cYD³,w+pR2l`3a)(`ƚ"gU?!<4 z'<.W|=*.F3VC⊚\#\|lk/Rs!Pkz"*6cZ]WU+qd)0gB޽I%<ۡLXl>h>\  e?   /5$YS81'$O"<+%HOL ,X)xV<0B޺غɂAmB^).!-%?dC/ʦ)E ?!Pȋ6‡'o!erX wճp~Q6'Li y薻 d"ZUԑ>7H)ӵ٨XDlvJ^(eLh; |"|huGxoHi|cF{gBS|Κ 4CX7Hm^8"ڶs`hS|9*d^^Q Т.XIɜ "ڦR1pȵ?ڱK.Ej ZTgԑA->(6WM.CD!W|89*c\^?j UJX|mPA;ڗqh{[ SH/XUXǰ/hƗaCRQ/Dۧ|B٢*W }ADr9, 'b3h:*huG ډϾ ů*h'R9v(?۲K2>!cSy"Sy7hR*xQL؏T^)!flI|*I'驼rRhI==!+婼]]V0+\}9vȠZAlT\Z~P%_U9h bH FQ-&|Bq)~5C߾Q9i\DEhQ{,pB+[kGV.u>ҠA!Cˤ6SJjHY>'(V1qeO4mq.p1t.gy܁m|c]Cu "SAD޴Af69>m|<>POL> !oeK}EA6>Џi nE_4K%S`uI:eʢ!~˚rH]@#!LXl>?YYɴ3DqY4?Rqٶ"-`TUY%,k>)C,ij^m-~TGX]O"URW&?ݖZCۡLXl>PM\3"f U\ʲDvuۆbv ǧevv%7v:ڕ Nڕ/Ю9$]<1'9%OUB+&8PL Ѯ쉠 .ZhW<066Ch}VX7,55}5CD‹HS%b,dDy{ѩB\2 qR?쐴7mdۍaE{ՎschJv4L@%ՔK6Q֠]JegŻ;kw%*Ⱥ|wUGQn| ϚƝDdU=UB\>GPis*.!ݬy|9*d^ R,d(ysm XU \rLTh!PTU5>jcHWk5rY-Pp @pq;䚟'W𛨦A\Mԏa!9B,w $ռ#!LX])BVU,>f>CCe|jmkDrۧV`!FMԑE.~bۆXvChۡDTl>,Mgj!VP;U[! T]µ특ؖ].ۉ%Z  e?   /!h6$Z81'%O"Z+%dOLh i-X)V<0BܺغɂAmB\).!-%?dC/*LM\AF|E=ʖ G٢M\i@V4=qv76*O#}g:WA;SwD{n> d!ZMԑ) بXF~FD;LJim|]QH!UKxDJ6!!9>gMhc> Ū rlg>Gi9,C'm8{O>çylt d]HDPXmSJK6k8U=ڱK)pS U59jfȢ-?s pb:ꦥ?j>ON5j*~, O>zCHe4ᙰtP4YSXǰZc6t[\u|Yq7OS1pV@&c"#?HQon.@Ws!tQ 5kJ;BUcq\%ۮX~ؖ]oE  e? 0^zA+^TDᦱ J EnؑP)"zBNNďx^9)BRR"+z Q+_~w\3=W0[7X:Y0>7+!%?TlX+  j\Qi|*hWW,cX}DM0|5ȵ<Bj~ztQ+ud>sjo7@jMQԚ>MgZVP9DU[2T]Qlz&,ed4DN  nղJnՊnU /*hNޕXӫw%OrvNZ+'EVJ*{BRjEOJՂj˻z?z`=V0bsdAz7ԫwE?J 605qER9,ǧǝK|. /xouyy8m.[!jmn|U +bc>ta2nf1'Li1=^T^1%wy9eD[c{\Ex2XƼ|NX~uCyzð׎9q|?2ݬ Ӿ< O_}2{ż1L[;χjh$y1@m 's O9X{m$uɒ<(#S:Q-e^+_ fMJ>Hr?1f\7OLoW- y;OEeJo9֜duKԻ2lpeK; 7 Ȕ%pi kz{|B=*6tnduѠ'QOt 8n`J%>ge\nh<>NGp>NE̼,j҆Dsèh)JGh˂%7T/,SBOp;GWdP;KrwGH ?iP랷>d ̰gC%]Ow2 h QЁJbGap돏YZ]zqD9ku\X)}&%v $ab*?pǧ!͂a礭Xq6q6qd7Ϋ^`GjŽPG^z!Jb*pGL*BBR#{ 'A+yG<0rدcS' lu u ).!-%?dC/*LM\M8uB=H`c)⓭'ߴUgPհVSgKJ}t>oi1~=)V=‡PjWMԑ&I}PO׮Ag7lu yC1{}ˈ#\E]g2!1ΚȷTUW n*W>Je] [z‹t&7H_W5g-ܧcB"VL=+>#nPR\NMgڣB;4ުtY3udPgJu,@jko+>V۱K10eTSVǰ\XamPl^y_&f S2`5XJ&~H7B}ڣxRf :MJenjpظC鉨،}jܚ΂ }UđBe|᫶ TߡLXl>h>Ю_X e?ڕ  N /Ю9$]<1'1&Oڕ"+%8PLЮ艠 .X)hW<0 غɂABm }).!-%?dC/ʧ&>zhXIrCN*gB Dݭ83?_+}趲է@V+q_nǓm<ܗ,@&ƽFh-Ɔ%, ?xtVʑe:Kz#`KYr>3?H >S|z&,6v44j[o:nvAPP// 6 :;? wmEW5MaR|ŃЅJ{>׺~^' jr65ZK,4E.jtwa$D!'_+kN JLaS7i%~ܔ)xt^G>DW#zѮɸii,] 횰aDr&$Ղ5/6vM{'qDp\̉ȓk"'E&RRLŤhDD<^&`ȗw~xWOCdquG;Zdq^P0fC˞PS%r,u2.EĪl ƣdO^~VUÊ[ vy/(]o_ѯ[S{t 仪mhʥ u/ՈHzvv/2k䭈tn}2nˈ;#|`|[wHahZӸoPsU="Ux>Jir\..F~Fguo6gDܥe߀b"2VL=*(޳Scڣb;ȵh ^mLiY-C^ֆ#l!DTj.m0[SVDzshY.K}^*i)!Qs)ZSpfG_l|*XuۆUg؆->֚ >ZZBj2,2rA8bf o nHg->KfV;82o|(0|V;+.w t{SjGL`gB\t-HMl ~ 6 a 8 aڱDU{*$d<̬_4'bNLF ŤI1IB:,{"({:VݖxyakuϩjM}ԋ~Hqi)!$j~)VajFBjɠ$,K6>Ŋli*HÊHxZNW%87EmUS 1|5-X,˪j5RGgl Xv/'ݒ%ӹ.]`@12"VeLdӬDedt!#h[|՚,eU=U쑀 U ]Y9(;p8ܵ>ꚖQ+wiP,Pͺ1U1SO b7 cSϥGv TaLmLY#fwȵ<ڱKbRM ZBf ϛ/WRpN{SBܥ`,˚ZU5?U #2gT2lX,`JS1ud́87ϠҚR3vPl:CVKUGW᫶rm.W1v ܸߜ֞q|*pX-ba `S/   /Iń'XXỎwgɓP,$E8XJ`F`˃`غɂ%>lChu;RIb&Z PqiN&Jl D64UmNJaE$.cW,}ߵ->+iJᎄmwc`VU#$:2H"A9U` ;>ܳf;0_~Vqn. ಮ`UđA5>H Ez57\<%Du(7ꖼ-IeU;"UKʁ7>Hi\r*Noϵo|#,ƱmK5v->]ؚwk4"TeM=饦'$0&Hppϩ?۱KahV ͠#Zu$8q-0Yscp*z|:&8RkUpv,vDXS1cYw ",`x 8ּn+ N3D2n3!+u fM7bŪO +n[Z~ݡm*NU)`-pDKS2udᶸȭݐԌ=jզe|XU+qd)Bċh)/ޔ> stream x\Ɏ0Gɀz/ _f1`! 8%CI6"'0$յ~8?uyˇ/~_?=|?-e9?=J^,?u<[,IIl;C!G,5c1:hc$AД}G&21+Ud:vU`UFl婳Jlȶ0nJə\Ό y1)ƏiuÔB^JlUxq)^ä0B>T2_r$J7EMqSH3ļ$Ht׳s#8ʖbf!tDvf#%w_a`/sTSB1oU2Nm!Q>["zL5#D !}yB!&keSٔ=X2Ą)cM+:o4T!#֬&죍}j'L>B$n UnG͐Z$|(s\;N<,DwTDq;Oeݦ"(W:۫`h)w 5Ԇ/,͠,EY1 ӆ 뤞Ή(_d ڋ_-,~TgFO3H2%3$Ci^W#a0vU7$twEEyR ^jAqgʞldqPMe/<, %l"hvjJ`;Ev]=1^Ӑ;syr ;cڅDXbD#e}Lg@^nu&ig  g = RcHWf*&wv4jʟr6+ypvwy͠!2O@XBԀ Sjʴq-JT~UʝPMj-bSUIW@rj1L(NQy 2qh3<1FȌ6߸OEdKr0$LaˣcX\6$S!x)s&wHY@^H|;26;x 9.u 09-[a8\A6lW菴 Vq'] ozE*mQU $4Tn򦾿6bjc@kJ;7Nݡ@n/e]h#) H|>3Q} C[^b$AyLVHkt>^8}|̯un}}%W {/+&fqv͚}zIi}nC[ee<)a+:̱G `+VOnh|N:'5M~Q+nWZMx0{] /7t-0h^n?1@_|hEz:*FEdнI  n Alo3'؉i;|9S2>6C}nɉ7flG!i"9agR%&|bzt,0Z:D678L(ew?MDޞ pplp,xN4,4wkCprdFVlxI5Rizm=`DNG@%~zuN8ܩɮdbIk4Vf.\p`y - 5 RmɥLxxa&[ N"v2*L͟w_*]f/4?S_J/9jo4̟hFh|߁u`< rM m&`JS%^ ZBfZrV8^(0>$m{{tV!pFE{=qyK&-8a0՟CF%Wv JXx#o \Vx `%y6 Wj!m`TL hDc~ajv "6#Q8agͤkf<pScݹI8d'pOc D]4xs$łHZӬ&Gl0#U@|)y*װs џ#P<7@.G{x}0}#_!u).:3{]{8?0FP|NA,U$LxXMQOx`)E̋opc [s 'K ;"Lw^ )nCQlnP{x=:7bQdll:|!0&IEQS&񪨿JˆjڡLD OW "bЄAsQס?E;`8t;#@DT@Nĭ 7`O5va8((h6?{RL;AW^vm?PKK&,ƗӀ8)=TfY4z*B 2Y endstream endobj 209 0 obj <> stream xTQK#1~_0U0;L& =@PXP<|Ъ,/٪׭z,4fo/UݬzNWW²֏U:[=lMlʢZnʂC`(t*/ ,Sdbԑ[gsl4F"Ց zDZ]B, jwE Pn],׌y%B>Z]yj)1k-*OYTу VZ벸8U`**,-T4YP[Ry`PZNvT)sth8]@L_ 2RPQ:3&u9qb+{`G:cM G՘=4^VHY I1KHP}\LFىcW::j69&Y᝛O 5{:l|)Z݊AշVh}N]l%yiA#G y&h"`+5%N"/ȳi8}yަէ&j~\f#A]F%9|E_W}&|O/BZ endstream endobj 210 0 obj <> stream x][7~7ph^b`cL8bJUDI NH_}yǷ_o߾??_?_~ۯ}t=}z ۧ_77)zHqׯ_s5z:.|Ιw~^=;Ƭf}~1tu'PwJEcw߈־&+c \=*c/Ww]G s -Ɣ}-M{(qsJ,L59OEܬ37olzׯn|{ o߾O*bŚ/V3O?~~"fhmqj_iyCMA!JMu&W븈}=HCtO="ye[#b`Ԃ; H6")]>1T9{M#f⨠\H <G-b8H8JfړqG}lDh`.Guh[ "cxpp$R-2lBg= +*aTf8O/J>ڢC6 k“j$ˬr޶034:O\*>?bfؑ֕ 3/*5tG;iMW^03[5G (xHQ.6jZBե"e WdI^rBpuqHф4S35>L;:8[C(:L溽V'T72S?:ɤ'R*]VKrŽ궩a+b v2;\KTPd( dddH3dȔt+]C#-$ζ{R66c _LU66$Fp 1`1)X 3MRigPBa!EgzJt-g鍮ЅSyOU{NQomlWiO&Ćq N| /ޖ؏zaԑEW8HlcΆpA|`euu.k}r%׸, 5I wUgU}\On@2 %l a/"lY l 3&lV gU%R.V6؆ĤϖdM`5'9.چn["Q!Ecdvh9CǮGCƎs9Q#̴`H'+>a9& a(5 a@0=TfWE >s @923ѵd\SĀGIB;qIr /wrLqEcTSnI1+3Ξ3Ȉܽ$t-% 2Dt>(z)H{ H?}[C/yՐf$oH''=4z(HUU}56 D XeVKp[Fɷ|;Kl>dƛ<_I-gv9G՝Dtc ι8mCґG{O,qy&zؐIM'(tB{R<̂3R7Ⱦ[úx?;(#!E3z|ћ] V#P0l\PfdqT885o˪l~'vź`.23b<`:"p' b 3Vs˙}1.JwK!px:8B8؈xA(p'cċwM.I[ʀnHOTiwx.&7z>Bih<l;iz+h 8#Eqh\e7;Bfs."s=jW,wؚp)ΪFp&"i'+$ ؖNδ3I5"_ [Cr)ʰE!yzy:&2S>,=n)( d&(|.PZNQxnIp~Q(1m;2b̰ 0wcOڂ07] ܻi2J#hVt@t-@Nv}Ey;hwV 3bukevQS.uS+aj!E]M}}%>d} wHьЅ}uwmPw6!$=4P|gWE𝬪w|/ >t.3w|k, [o8~~DM&W8S\r ZTQe%%'8Y+#8mC}G>|2&ORULvZf4i Bldo]Q!ErEt\"w i9#wHфCHsw>-0<+ih3I4$=$9!8AUN4]0xs,3ih"~[ >'vpxG4ٿz) 2]aΚdCG43xF{Μ5 s3uTCP9T< @˙!cdύ#D>#`<񯊻\ Բ~!ڼ+}hP~ B]DB;MhnS֮u~j[ZUym C]Mۜp)W|IdG7]$'=4]PtqWEŬbywO,l cTSEbmA)nݒ(QENЃqdDM{OE(~ҶELMM|( v4?Fka]A);vش.KߩIQMb@ 5:IMw=uU1"w:v]Oul"sb]2"-#EFwK! Y.%Afl 68! =6z,o^OA&>N1%ځMKhSOr#(=֧\ ?G֏|’a䑢ȣ{d"߸G6t(nHeZV@"߸G6o=R8u$ox''=4z(xUU=b2@^)y  IH~f ECw}^w` ks)5%D+ endstream endobj 211 0 obj <> stream xͫ- ?ewH.xa 4EI2Y$?U,,[@q,H.U^~~?|O~oxyo>}凿|~QaQ%j凿zWpʾʛ~ս'^M_~ouutgPw΅sw_3&|{BXbjt|թ5#5n%yZ^NkoԢ֠Tz_yI,ʼ~߿zGvy)E-˯~w/?aج^/ѹ[O*9f]|nrjI&>6bܺz]|(_( S%..i=< >v~ z䦒.8:aq>#/n{ű)d3ھ bl45Qg㺔qP+5opϽͽ 5iU&MZ76 ̛YZ-]?sO7s1irK}_4߻Gq=kPJ#y&l鼵n9D8B㻒UUH=(2O3f#Ɍ`0և!FY0:djbٖFaߴEiޡ-pԚ^S,n4JAx鑾-oHB:pʂw~c??^,_?=%̬6; 6blHlw)ؾq.Ņa\`?lk*N`_`3VcO4>>M)hg U a"$*@WEFR4wH[#9,2]jC; jv9fsݸy%Ƥz釞 kZn _wVH&g$,zyt%%4N:6QzѶۓvL ˚G$: " yNճj!-//q iA.YfNخ|D(NY~X[`1^6"aGPM%o®!\ i#.j= FR4O ̘0jXコ@)W쏮{A2հ 60܉xBat`#E`հkW˫a\V<-O`ar! ݯ-Y$z5,RxW $ E LG UKհ}zw!2wBa+Z d٭{W ZPd,@{5׌BDLvlj *&cU#nsCI_kZ\#^Ӣ\ wVexMkZR׹㲵LJI.>(G@*QPx9]jt\WzࠗjzhJ[!p^6gD{w-= Fo3B^zC)'PB)Q+>Uʎ- T|t Z}wHwhg侃/uwC_A%051J@%k`R5PJ(%T隄vȚʈl m}nJ!" : EPAGNYDCRБ-QZ*P&xԢv[=6CTVAw2Z5gAKYJפ؞tWJ-y%'k|Fs Dt@h $ЭAˁ0ߕ@۳O}1Q="j{> e,ݷBp+ξcOiP% % mn(9a6TJ*zCu*$?sdUXDDUa9X{=kGw$LSh*;vM:f16u#(#+~tNC=Qs_Η54Gd:*yrn me'>zź#,ȿ^mn9bZaGDa{b 7Zq{j Ӱp {?׻ժ#C91Rz ;]SRUڀ)+;HUԝB\(N UYFP;4 -E5Cl,c~^=2g0ZJoSq-0̆R$b &پ#~lt`NPN{~i?fO{_VfG 1Ra);|{@tzo[!yd=KCbBzF >I_pU 3U=)W/2ޏ};'R8g}ٷQޣYh[z:7oSm()½3tDylam e6"Ahoi*pg9p->AN;{˹z6B9^:Y"Iދqw}wy^A-{B ٻF, 5񬇇xAb ^T1?,`p֋hi=x` 2voi)xln9w߁xԗm ?mҺJ֣hK է-0 #H#[{7}xӁh/C$C/= &,k7Z>$&k MïW=pUŬUp;].Y.VQFn"&HIRD2+-K {bmH'[hg7..w4$pBY3T5S?9="=´ 9|I|v_-߭aⲮqONM&as礊&NU;]`p k*#mѶaG,# .-EYQfeeݒ6lEd}G$v;cdh1= AφR$Ȝ+G\2g{D;4 oCwHwF;n.Ψ~YL;R|/f0j:YONUPbssH0 uN9FŜI*Cਓe/PXi)zB향t1*^2b/3*]ͨadhYFg)dKJSQ4 " ;H3!EYDkT}_Sn] Hk7'=IvSUk7L}C Uo1zt©O24YF@(-E(ݲnߺr4zlEd]+W#%QmAv3:JA#Hʳa A(JSQ41 o|b;j{n\0?Eq{QG(IfG$G'(.?@!]>?A<F,Ss1fJ&6"q/*3MYbtF 0=^pLU 3#)Wz,2юVlJ$5"0dL*Yi)bmWn9;Y06LFlLVWqӭhK[AGc0$#H-Z+ME)c|߃MC.w ֭wJ+9glP₭9Jq)١r߹vgWJYJpˏBn U\w{d&8#E8'Dkq+TQG 2YÄ|M=r[!=;fldi~HLhΨg=<ͫUC󢊡wZ'*@WEFTakoG,# yl"G4v˒|su ɑɃ3o?RTڿGz:zܮvpgd6"Ahpi*#=*;겼ڼ>5VurV_7|[QOa:@Y"AsZSwP3//zz}o=,9{챖!1;|z8WU ߋ*tZ zz9⓬4A{={JKfea~ROe(##~V5({/fK\*=os߱1헣Pe6"A_~T~7's`][PS|e&w{F8LfqF$qF.ƹ&'TLW !R$ȳw,S|-amqj923]ޔRvR*;xޅrk 7ᇜ> ?R$?~޵ކ' aу''Lיk/;x=+@\6[Q66K4+NMf-9OSw;Nz4ì=*>4MkӅ--W2v<߰-p2֢7䕖"֢ݲvߋwCcv'EʛS ͵7BٺOd! Rm9TkM|gA|<Ӿt8R$|w~g{ }߰T)N Nzzꤊ*:S\zȈr&L.gA/soQRe"[K֩6K؈ 4_JC} E[ڣ?lj:rif)dr>4eK/}吧?lMGknRΑut?<p,H$~/N} r-4Enn:;Mrs!B]N۝hN-ĄyӼh^U14/~g*6R tVdD[9\}:9p423RDsnYkoɺCs.@zu>fߥd]ƢكFd'd6"A/T}. } z;Hເ.¸0X-߅~MΘ-77PyCb2OȨd=Yg vM-K`ʳl,x]ltdNbdVx7&͑.~|l{{U鹙c( ؜"n/EhMռ=jo؍2j.($JjFTz$&6-k=KQp|F}Vt' +i~Ŏ{m !@+vA>~Q0P>Z~O}ߟqcWPf ճ7s^SMzC{z8Az 'h> 4dM78=b=#y 9|I|]HwK{2;yLxC+Zx-l"5ApzkrVe$+gN.z[c1) j@F^VZP۔wˡfϹ;A'$6Fl{2JcMz]gdNZvȞщ:zl<FH Mu,M'ݗS6qinpUج7 ss nC1 5R$5>=w-ԃsrkz>4m\ڋ`ɍH x^Nk 5@Gyñb`^T4>vT %GQ~{#ֽUbBpAn3aI=FA endstream endobj 212 0 obj <> stream xͫ$ ?qfW[Jh{ս=4> ^=YR!E(2c{U(_˿Ͽ/߾߾~?O~__׿v{ܾ݇;}SpWuoߩ_~T?^=ýEUՆV<.-)7b}>]ԝsn?~P?GB݋SK|_GK|Y K5N 6Ch LߨZRw斜+sן޿=;n.rS޿wO}} oa,^ߣsOמT}C^D_ilqOo~۷xT^ݓoS }(_({K06J\ ;h&uX{#Ǧ&7tީw3rsw,-c>V3aoNygw_ks}?o>.(!ݣ(p kCs7a6bߣ`{:-on}v7I5d׿}kIxs0}ڸfԅvMF#EkULwυ\7QGA<5t51D}6$|+Aאv̵WԨMJgsjri`7hؿw#a׏rԠF"L<*YiWG\U"O_!z~WRJؾ ~v3ӌcF_y('ס? LEO<ǾenXЏ7mC iՔF!sBn #y]l4~,q%汇 O9́{{=I;, 9*}R,GdG>im.`u,3BJ vZPa{دT  _?%̋zOkXlt=y>n(6IokG,'Gc6yYgb9ufmjM,3'-A!%JS!k&WjO@QP1bC|{.>^ָMI ?=qr$Aʝ$h}B a{n(^{~_*ySy`0!gkA}9Wb4f,H` s=Ďs1n>'˲N&?L]78 ! ;\oQmcQK,q Q;JM6> ꯑ}Pu(Tm \tH U, aq-9G]d[vv!E r nnGuΐvE.yQ7ɸisy4ٹh/oz'qQVbH˟f<8J=b6d`$ȭA Ǟ}RAv 5 'Xs%oz[ ~v6CfK1SZ Y]Z4PA QZW%Ti/SZSsIi33[Z,3rBPfgNY.[OJdO@PKkyN،+t ":yMm"+bgURcy[[9pTZ`26G_ plڜy%=z)Jӡ FbKSa~[,`VwSr^|.듺,U̥,{ΑҚxf4H$ɀ/3ܽL9i~%8z?njɍH\ w9|S Y嬨wUB(!]LҴ@ @UFt,Ռmƞ#x."i7ACM;v; mY (v&mPA=ShY fȞ2r1&U#Hl]/<(܍ $sr)1Kڽ67 b-7-zil਋a54CgM2# td!UڡVt6^~:w; @HS"U"ZD֞p |k7nB'vF搫)5 :tT5TFPUu88m+T/;HU ԝBh7k"'--EeC향[̯P-m X!_/k^vZ ]AGo!z6"w6߂=5:wgC$=|/}_%-%ZϒgQzxT=y*mEdDN/ݫUgIu1? ! z6"A x 2g}śwgC$Cǜ]:A;R|P2^X0j:YONUPbY!*@/rN]p)m#N`2Bi)Nl3+-GBK76F|2oYY2Nt'j#z,=r)H9#:P2gO3}sсw9AO}I|.9%ߥ~u-RF =dQz[詪^~kZ | k*#uh Zp2vAi):$wR'Zi( #X|K\IGd֜#I)I; Vto,C l!EL.TIm|߃m9E5.övىh՜0:GRt] p,H \@"OB~CғvzFC$_Us)ޗ}yϩɼ=,zTѼ~LZ dYeDU2ZQs.mߜ=p2/Zi)=:}w޻{Ve.i(##l7J="^VD 'hBi$կ}0ýh5$"jIir~5ͅ5/fQzxT=q*8ECLI U04ÓfΤm"!p271f݉8nWI~cϠgs3؝!筜.k=IȋH"EUNA24悭9O|m^fE_;a}ɵ%8:gG$GKp'#/}hE>@8) *~}hp^Mn=RˡhT,/ rjYx, T UΔv\ҮHJ;SA6wπ8fhˡLz;dGRwHwx`N;ld̚ Yb5>W=\<_T1y~;SP`p "#*hΦy0ydy޶Kv(6rSxvq Sx6Sx؈6/e:gDΪmi! {Gr0ʤ#H--Z+Meٲ_=w`=B7opoZ r'1oPg0NC BЂܹP~AN;wCCܶU^@?[3nrs!B=XS]b21ʨg=hMVUhQEOf- >Zkm6?ˬ?g]$s $8gmTtڠnYG+0G'DFP4GVnJҌXslkcFd:*[ѶV~5n׼B:9ȝu`$wŮ9_iM\é=,zzT詪 ގHU~?z }xn!.c.\ee$:VZHtʍ%wyA$F`$Y8&*_Maѓ?O9ޖ6q {G/K0d6"AroJ+ME}4/9'$"KN_5+cƅ-r%&ai4UG!MQŐf;S1`p+"#'Ȍۄ4CHeAJKi1[4n@q MJh$9]у?CV2ށd5}/DwX<{s-2 x1 s$E#TI*<n9aaK].u/L\Lm@\`Bجlv»dBQxz ᪇ ᢊ\BȈ 0^Ix/ AFN"h|b=6xFԻ/wҮ1?&!2RH 49\}'xX ۗ?Rw3 s$EMT)<)swy94SFO{gOͅ\ uLO ]bR3jY_W=\^U1{QEtN dd^eD{M_/EW_ll'suh]mcf&ݧaG$aOhlo<X "ZCx*&=I^qe[ VIl%2Sa z2)2x`FLe7UHtٍ-n+A+.'2N,5-Zo65=E4 X^Gc D2C|BHP,hf4U2K?3=xDWWw,'"P}K?E}kGSt!"I"OF.}|-U->X_%Y^X2|?Y-Br-dJ,lÖ=LI{PEUS~gJZR tI[d$%SjpYfNXd5)4Yvvf˿5fhMGO8eOn< T`[GL?ٵCG} 2/&54ȔaI="7 endstream endobj 213 0 obj <> stream x]O%m0g oK4$  g]X ȷO((b$]"UD}|/_~?|~_~ᗿӧOw?zMlɛnWhuz0.EV]5W§?ܾwo]BqGq_?ww?0qn$ͳd[7ł|ySŬsb*6^,buB]b-uǏn?%YfY֛XN_no}}8_~j[xco}"+׬=Zj}M$b ?p1f]Be\+*?bbṇ 2`CcSrDα n1|#7v~QAVw`)Lg?SNX!~hI@Ej|@艴I-zvarދ#9Ő=%5jQn֕|KrBWL\i%f޾֬\?g5)Xk+f0jݺl#d͞n30c(9]Q_d3G&X^79_W* -v=~!J!{Fy1ID1 Q"Pv2&RÌD PiC=#)UZOJ '$I%!Ѭh{`Q=( J-XJv Rr.O AC=[͈a7%R-tnŠm#@˜As=0`2v<, iaHJfGh:4#L;#" D3b4`BI.~0=U >퍼טJB~ 'UAȅ>嵇!F?%g2e ?hHՇ`of%DIn %6YE+3#F ~n[cl |E^z' \o{?{;q pxa2BdễoHzqi8wakD 8<'<[~C;|Q)Bonz<1sL?J :LFo%7Xηlt}'aŬlc15rCCnl}]oh4LVaװwdLx,4&59۬ \D rvyu_p-mc cS7b8W8 !0A\f2ݾ`yey5:dI ك"L@\#U5ACzJb܆4RjiF(tH+mV8mիxA8^?֞T$:E:v=$YOB惷%gb)SDIjXBdA19z1(\ay-f]45mIϩYN2POZR;Μŭ5:S")zeYFZyh wyX:7KIk4EI YہL ^E;2l&ssϘ̷H5G607=&!a8A[܇}0wa.p\"0(H4sF hȁJR(.RiFtAذ2b> ,c؃` h>ZrFZ %zh3aCRCTrD:'7\8;v6وh )gX v*Agpgk6āaօ3X&!Y]wv̮SxSpz55Zv^QIbի;k b|ռ}~3؟#[9P:iCG`bj6 +Ԑwa` ֑`f378zj*jBfZP!āa?2~< L{e~>Ia;ac2@8<(\ %ALZ,!ШIN0'y"hM3"U黛I} <\#㮔iWBb>W$7e Jm h:chweR%oj0{>Óo7mvRwy,[96u\r#1# g&@O&c`1LKژ0== }'a АNBXz6(›0/oJ~CY 2#"#eR@)'Ymzwk6VВ5Ҫv,)tiqVg\53Ϊ61=9=בa,xfx@zYZWk=ek2{ hhfmv;8u[CIMXC9!vXwV59LŠuIÂ[ SP%U.zzWD0B[~Gf+1+#˳x2P~ڝUN6^!WL{bũQ1ܖW Au';˨><9K vg)igN{RʄZnG8n7(|M-0`ZPm ូ\σ.ڴu{v n[ߺ)+&'>+v*Vs5UP_.6FA* CSКڮ*,S5Pua]]hɊ JVb[#~C$m֓j5VnzMgD9khʊl'gMԍK|pD|Ur֚qRNΚ}r50<qJ~ҹ:uR [buC(?,b~cCS:lRv Ew (sx[JqtjN86R:l+$\8=t? 3#F9wlBac59;?(ܯ8$ٯ~~Ioo Ww l  +3+7XaJPLjFrIzPGtW8b!=4B4DPu:@̣*7-4yW5+9}m:<wJ0VA*JrtW=g7V7 iqeՋ? ^7g[*q ~̵JoS(RKzA[;|G,m 6gy1=6MMȦ$7?ۇ6֊ep,ZN.:U/؆mMaLWbmVaOR>b6ϧ,I^m|r0 * ObxOaA< ,*T hQe䖬2ԋAx%Q'#]R&˷iq'u8VIfMC)YUnKm#fhM47e ]elmfo'泼ۗxHؼg~\ι>qO /W9e3D\B9_:_nbׁ/E0w/L/c6].vH?q2!DA+29!BqQXQaČ*(oxL^@0_\hXzY ƙDе^-YkX*-ny)=wT'cfZ*1D (:t@h>*=sSDI>$^*8?@vvI۵5lӫkK}$H4Pl |$8#AaE 1(\KoDjǴ 5SP[[Ux\nڪAȉ`jkv[_UIq^VE\^-#lޟ))*SWj4`}WKM8ބXB%r[EU*7lZQŝ\[.l)cA]u|e}셜]<~˵NjԜb?j -7햳Jk0N0dyB}%}%[b΂_(6wC,X _2<ɕ xk!bmrUW^˰ȴ9NE(fwg!|ucRW/VQoP׽ŒoD#2u>R".H{z¹׸be/ƘG5gh\"zz^:oo~$V.9^R/!m|s:BQwZGoyHWQ$PvY=ƙ \+O*BÉ/T6)7*.?[YL%$笯 Tևf Ո7ƒN1 6>T<_X|fEjteH ȽM2Cj q8g -0W%UtKBzµP^: )Iz1Ϣ'uB}V) 1ݶFM^Ja%NX><bıFqٮ]lqJM@`ЁdCHfV@2}J8&H J'% PhNJ,A'%i` A"9: +[f5i uGYqR:u( if֍#hY@Sh9HˮFX5QS#!ʶ)&\s6;eg@ř#)'i^#jݰ BDQaMbP&WyS0Q*aMF:an.uBZWizMҢ"Ph4,TDGi$*r-Cg9:P)QPhtSTt.Xw#g1b]FCZvg-5R}]Σ+V  ^޷rBkG=2!c"=Ǿv'b!(\ƱoažwDi!P(O4 ܒ^Œ(oTN0ByD.i('ʇztnBˤXͯ8%HnKU< Byc_{ e֍#Xѹ)k_;YcRv'gAyf;Ĉc;5>gN֘m;xkdQP@5)&Yc MCg *k\XY̊v'!(\daœk/k,W H 9hQgsKhQXi6/K#AJyf4Z蓺 p>v-zYq7J!FR 5M9m֘CkD%ƶKvvdI۵?3T{zסls|]/Y∭k_@ć **+_kL> BÉ]"ƃ:  D8e} dOղ>"BPQf]AEiO0@Eק1+\i4_Oҝԧ.({8] q֕jFӉZ3Дu8Q -im XT6T!ͷ< K._RDc<_3x^RD {Rl2=!q[XQ1( Q3 V->a/PaoaB[^Uo!Œt4WiF^B,A1u-NcedW{{ d#F̦ܔv0- (!=Cx8W.к >Q^xy#Q^ۼ0vi|^?-ȗs]k|N2ڃKy~m}Aާ(bXŠw.=Ӱ|vw==}'a`{>@65dAAdJ(fᗀpVaUx/VطG5yTm9ue s+u$IG0| @>dKLJ%ӡCxtXPcaE>>>^4>ui&ᬘj KH2t ] ^, CKX4bIQ~a=b -y6o8so s;go#`x@7g4>VgVcPOfǕc`YVhOA}CP Py;,Pj-WY-:ȓ*aEX[蝼{2SO"F16)k -s uk@o~Nχܥ@wAaN0s[+~PU>u?bq?*I2v KX$ ǽA~;C+ /ܿE 2Rl2{CdrƙjMv83L B z2V $ rFs4 čg=E"?3bQ=I!N endstream endobj 214 0 obj <> stream x݋$]ѷ;00^YR!E(2x*PƯB_?/?//?Oo?ݏ?~o?7yz=~˻~Z''kMŧ5Oz|񬜿k{~UՆV.-)7bo>vwgPw΅>3S=ցMv!bjt3b8ziqϢ<x6~"ALh%4/}śhd""Ik`r~ ̥x[1YG &#9asPE#b.fh0 L3ó[Υ31YFt~!e-]+f!. b/ŭ4C:5"zGy6"AǺJSQ2;H3!Eߡe侃/uwF`.y-jĄ8 NSU1)~gR tQSd$EQe0g6_8d]+-E+YnYLi( #Vg7aVٯ%1qj7uђ= AφR4ϜF%T9KbNaI,5Kb c$ 3_;anxk$Fx2 5R$FKbB%1}tY+}$o{y=glg  ~a̭)% cY_ٳva젇Y;ƪ*za,%I0 еdԒfxZ̩O3dYF@vt`eɮݶ5 љ1 ّ*UtFvtrln";6FώC 2RH c(Ώ}X/rtot_#v5a9עnT)]u2}^r/tn.rsb!>+6+ YbwF =^p|U w3;)Wr/2݌mJ"d|\qi);:w˽.n24{MN ֜4}Ng+ӎh4H Zע4e D}ޚ;56R95oMжh>a}ɵf:9O#I"&OFh.97'D.U"Ccy_/&Br)*<0KL5۬&zi򪊙&/iw2bk`V/y74]47t7-E)CxPM8 m494HMOw]~z{ NJxQxWܖ!r*V.K4>rp.A ~:* h MAs. e$QsmS6bO_NM/a{oUww4kuoyHɞ Y"ASv9dMX| ;H3!EYDss}.xwk$3j g=|z<_U1ybw"*@WYEFTectM7ז.gA/rrKvutͥA$6K؈4_Aƽ ^^n:iK{3@#tMG#Hʳa e9l?2e@_veu.gWb:9עN<IN x'|kWm-]bGF 1Xpx<U w+~\*#Z?ʿEx=Ul0ZS똬+~8tţ^dN@*.o*_6r=v_eɶݿb1 < Yt.Kz7o/խZoN} erV >af—E3(ؿ\ O\hE 2eC|# oz,@{?Í~Q0P>zk9/K_u 7MwE>@˶W׮; ?;qd`~Xl} ɕ~~x#avD]bByF P>)_pU w3:)WZ/2j燵~<p2[4? -Eh~향N|m(xv__~ »/g 'mA09)a rT`^{D΁z &cR)5y!$W4<y@,H ʟ돈}g"_^NbZʗs._n L#{[_Br)@*pPQzxW=*ECL-O U勌w}z[)_ʃ\Z(9h[zYswic#j-oC|N{zYc6W'mjW;CDSFt8!ET}{07;0Kr߿lv~ s!v>ӡ,)|>~wyn#~-u"ʈROaGN[bp)Ks8|Qwl;UUR`rb=RzN3\\ezlЕr=|,\"{mJ~ay= cdh =&a jЕ-[G.Ġ}y;H;t!Irߕ/uwİ^ `2QٵEdԐU]BEL; I dUi8#o'1 !&Ќ0!&v"[V< b03C̢Nڂ =p&Fg)CSQ\3l b6wʝ^f7ѳ B.OqrI⌧y0 ,Ka]/6ξ.’tMwm-~X 7W(BQzB Ū)*PN`p tdMש֏ < ;nYoׂ\*zȈrjGۡi !yNC 2JH<;g$;5eg;PEڝrqy^ ,{`lU xhĥ `2@Y"A5=p=.vxyRٷZkz}|.@%Wv[?&%9kK+ɋ"$ELI;)I %yNf}i #ng}KKu;w}+@G@իWqY7}^gC*d:"A7h4y}ýӾ˙y;H;4|w wn0Tuov p5@GN1bSTYA>vT %GQ~{#ֽzFV ;:nLn&ce@$| endstream endobj 215 0 obj <> stream x]]ݸq7p.{oRa- A]"ݤn(+qHq hG!O?o?<}}×~ßO{~}=yg}[n_?}6UEݭ}7~GvګW^n}U+o^]KR*./ɤo|Zڻ3;cw_ߙ߅w}|B`|ɩ%>m5S|ZK9N6ChTf]-At;sKܕǷoW񼿛[L撻/7u޾}矿}/f4{hsYfxo~yܽ'wSj }(h t{Zb1*謂O[=?65}pD<8N}TvGn=1ܵr jcgRP}6/νOFkr}V!<}kNj WʨK[ rˆtz>PXFkCs7a6bߣ.~m\#X[>s!ՖxjZU:n~GW̦!zEXC=(]]͗c1p1 HR\Ji$#[=JB˂oE {%Vv+xjdFrcCr9ei0 ɶrM[vNYzZv=**d"NjTȪGTD#ܳaF(,AKKOFl#2`<v=[ $ш͘v[b7ۓy\Ȇh\g'@PD<, %@搣 h2!GnD"`1pNg8Ʒ$ E) l{a{`!ndӯzMa9z\þ149A3C BhXt0gS"#IlhHk#D:áYdN65 $ j.9 ˚ s4kMƩs􉵐fAF':fM@L̮d̮ T. D 9tA^Z9`N" "6 e=EYf҆lh(HSn,𨜝; ae[9GiޜTQ_TAjg#w;$zߓ=.Y/ 13."9eSppK t$>uxo"d#Y#GC`2Ne!T6 hvN9@!]20l TI6F[#|]dN-]3$P,drW=E+JJ<$4a)H.yhQ9n NM #X@CIX \Z@ "d-dh=~9dp;LauB'#2@NFT2r! B%#2u,dD$H6 &# F3Fl2" l,gXOddџF;m %r)mJ1m?b8R-/`=DO%1Z~i) }-yD#WP16Dޙp O.|.hF~c $#0lRH6 Mv 3 )zV:)2$a%_dIj+N& MKL1$ųJ`6Y@׏Ƅd~,K>PϢx5l NM #X[u䆒Exq\ۂJ NLLL֗&۹b23I1cPa@2FP/PAr?@D,a~{" c aX@wQƶ)\*,iY+C- :O!-#Vz@8w:<j饩lF_QE:myC@ۡIuমٮIAP@(!@JML @ @ UF9EJ~H%_8eTmJ(Ek@NYJ~ [S>( =_ۛ_V߾EsnYSiݩ#ۺ6 d00بQZBkl#Vd:Tj'wbFb5Th?g.%uvҋΞ%:;yp::{餅dRD$I6"f~c?dikl Ae.Hc+A bۦI_;_gތ̈<QJҠ*|i+ iB\"*3=5 Oed@ۗj"򈏈zvJ=!FS0@=PO#tjZL=갑b]+d/7HU휬B%ɨp͚E..2,ǶRXhnY~ %Tӳ۶lJwpR) {GE{zAt #$xSj_^m_Q%:Tmyf;$Css}^n;kK[e]b6 M٦plS)P vg2RtSdDɎ6/-).dӸ_Zơv2^ε<:PLX&8 9y4.1 V@ 0<FH-=*򗦢h2?i.УJ?m;3! PzvpSlח(iv 004g1Mb@1L۝)ېp6EFT.mLSv5@i)bFV[ib/+ց`āiRTڿD'b^NуF!tH! A h]@i*_=`Dh= 8i~]vpSlׯ "ɨKL 9 N 9+T(SBN;YTQ~F677Ec,#`Ю(-EQdeeY'Z~i(AJ,/9bTђzHA )$(ME3YsE72zh~ŖSg֟~:(=qQ%p` Q9/=UmTvaw%x6!w91" 2qu eru\:K,g 92aat>I U'(LsisAc,#`JKFw漻6&;eT'RvD #R% |M$e*4*Q#R &N(=q >s88|As_v@a_.]Oa6]Re`T3O# ŐjbHu;.p"#J#3 fmcݠTw˒jVN)>6WXܞ+c dڨG̅HpbBTXKq|߃3{㛷^}Yc]9{?yrR2D+7"J%=|y$Czr۹A=:^&gy/en3ب&\r[cMdˠY/r0-p2.V( Τ(\贵HV3ܽT* ÂǰYFY }`eVm j,ֻ6hK\vKyӵx҉gND@H[BSQ=~'K#"m!qf;$]@,uvr.qެѐ]X%&q8q8_q8_8_8۝ɤHP ЙTdR;y6M"ym(Λ6rG3RѠ]l#V=g 6q]ϢT;qx:~ LkbJSQ4}M]a|ʹe^?`L ` Ov]rz$q=vnr_:w7.x٭ڃK.yn]b2Sg~p3)-PLi;YUQWv5VV/.q7e]Zh*%nI,G+$ƉXiQA:GgoYvȞQ3UJW>Xʾ.Nzq%+큛6 DĀ CY%&dv*G;nw&!@*@g>EF'i}pe$vo?K[Z(me)g5(8 ޠMs=Ƨc=No>"ܹY/[!G(B@`P 4ЗGDs̀FbvHb;TB;i&5%-Z.1!&DSq8P (hv%4Zd ʈJhaXBSihh"*AKѠ}s|,usɠ=r5Ķ"2b&N ?C)t(! AOtVWc nofʁދumcu;F;/3yH<ѳA.om[ziy˃@\^kL̡-λĄ`ósعB1\hvvspZ +| s*#d qg8v2v^R j|,;u_-jDueۙ(<'*}Rv}K䡷j4K'pB@ o-M%Aު~֗oK09mwHR`7{Bgv[OY78CC 8l6dzNx8?t?p2buMחr+ti\_!م5 C/Y!tK88BSkJ [T5_vӳ (\م*#]z8߰ dhvZJ_F lҲ+/:ցzAJ8g;[kuحٱ|Cp'jɶSF̍>|L{3G7 zTr'l q ڟ{k\qrC?|BKh|S# l>O6mɖ d;m^ɵ\|)|ZKLj6iu ŤN鴚 ȴʈ03 wvRN!I6_-MEg'NUO:f7ڻ3_Fv,a߰ձЯKbDOaa3`?/c#.mEcOzo9X?ֆvVDy#pD8M9y3B,gN' g!;H@ ?J4Am0[E!ǃ Qʰe~^MOupεAuRg >`2)p Eg΀su+T %i=TG`sipAȺ٫ѡ?ը7:F dݍ|I ;p.A6(D*ܧՇD2d|w\|T(=owƇEj> stream x]]&o^΄LB hr1dl.I\eْU!$3%X\_~y<=}z嗟O_~?}o_/o?xy{}|ӻ~̏/A?6L*>&k_zyrM;՛ysѯl}M+okR*ί٤_?|^L 2\?>~HceSIgvoA7X//q蘷i vqrk&5~r摜y?˝d1Knjȟ~>~x|1/?ưxlcbIǗ?|^DY5Zus鷫kyϷՔLܞp1nRzi =O>G4j= }SJ'3.On{MMn*1ٟqڸii|}r%|]8`/:P.cMle43X6 h!M~iŅqD! G̈́4޸7ܻzVڼwm0Geնd Sk\_*oJ_:'v’©^ך0ju0[5GqKő73" {*VeH%`V!I6i jD wM7RrCd}G%QQ𻳻qqùm{`r{{!.Gogԁz{ +^N#%)2?B z0ܲ%;sO Tm{ϭ|` 1_j'q: A7[|_#ηFhԻ :zwk=Cn ܲ`+7ƶHZLmͶCn!W0 a߆| a8 oAxY~@h!4'6k [4FG ",^di!SmZfG ܎2ˌw& E[TktO&Yp+4_vw ^F x|kGPP\V]t WǾHj{N&pRC8cĩ5Pc = ġdlc 7oBqy[>014?s@N)$h(?X:h0?+V?z+|n]/>҈s,2rWG]fMr@L8BW}h.֑ '?0 ۹k~ЍԾMp¶ 5lCC j60ޭCqamʫe1ϡ04@o¬h1[XV"h0R5Иq( 1tИqVÌ{B ,H;k12!J0ãu5ʂƲS5ȋ5nYUj>\/z{a[zt;iN--%۰-ow/(+Cz4h)`Z a-@VE֥O6YI8YSj2'gZ]H-UWUcMW^=[vr;R #- ¡K]d-ؒI%3"|XB+ b EvQ-ܞtͯMoDoj&Pc&*0`n× 킥xZ-–P-MMv{rTi"j{f'ܞPۓܞTJۓ{ ;xY~''$Sa ̱$ˌ!$ɩP!QdG~JubȽ6G;S끺Wю9[ɑ+8

4daj5K6ȏO.X,\ f-V_عu^ʸ*t -CP^c.S5Ù{݈Jw Vˈ4 J5.*mEEֺS5ރ{&5[8x%̩dN30'̩dN3H;oijUlez}Kj* pMjj+!'#47inMo\*-EY, ;O*ƒArcA*Fw%.f]*, tћz9/zB~!;^ho=z0"^6XG/##Jv[am`Vו, ,ad=,j8M,UQw;!Ce۝ 9kh;^82)u\y퇖"haeͲY~{j$nRk պyglzzqIa{,w *^ x'[ BY8D `P)"!vpzaHN^;ASHoC.ER,be=,j8M,UQ8w;!Cey;-RZơ"p(ԧJKzer8fޤ}Pč>a7> N:lRiSʐC )1N "ȉvr`Dȗ-×@NDJSo97=5س< èz,ϡ&6sVEdyr[Z ;| >x{G ?>E,#X&(-Eʚe!'.ՉI P.0/>]5nu=jH 5caj:aAt|`UHj:MP& x=ud2P%xd=Ԝ0PS4qPSfvzwC Çdƻ;T\Z Ԁ5YF5>QPZ&5B_:fV *y5:nPm؝,荟{ pC `͌" nXJ\ 4I5)OOÂv@H- "E@4BS4宼)UU羪dچLaner_a Qm̅c8`Yͳ R^aEWv =WWCyA_)ME´}{Ϥ tBrW4#"+Tcq (WNBwfSPhBz04 S{30 gPܵ_umw:].3;N_G}ɶ lȝ7i5# ,zá=&6pVEr1Z ;| c8FzlX'{ w/ %0>V%0>60[q.]@tNJ)U|W!90O9ه{טyNK`pQ`<:Vڊ(0=6^|&߆+.M}nU>k6qL.7t@ W0Ip2Vte5ؾtgA+v۝*B ][rbD[jp0̀[- gOTd pj2=9aXMıJj~Us#.לBF)LyIQ 032hb!([>q (k%5ޭqwekޱ)7bʛ2e^ߟyuv;\1Yo*{֦)^숒b;5̛0 *q}ӷϩSe}_Trq7L/Rot.;^8/)e;-S11R45&0%.brb[{х53vu PqtN }лTj `Y KY@+%myɊ6,j(F eQE&EUQ,jkKc!,e\ԃ+/1gT`TKv"#yTǛeԲ#e/0nPȍrWFd\㛾:_o]0dk2c_@Ǐ3a_@Ov~3bHI̯۬/.wزR+ؕ1NxZjӆ^s_Oq: 體k攍2c0UhN 3=<אSւDAjA)6eDYO:hӟ(xܞ #to秭kl㿻Ā2jf=,=p4࿹ہޚ-> dksNC2Aꝟ6K%.X8ewO/|x5"f9kVя <_؍[?YH=vߺ"@<0W E2:IFv&,Fܵ%fS,*.{&J m]7_Tu|R:b>?8X sԡ}κ|oOuj]SCž5Q:{:{PoF P﬇އz&zUQ{v&G Ç;ˌ~GW_`~ #z7o+qw~^_؍*H3\sb}[Do{)<3z"eB Qb)Ւ"ool{7ޘ7ǝC^u'7G}g\2  G;;]a]6iC{ SyWn% +r;yݚǧ.1M2jd=lnP&A<"r!-> Jf!,M nNHpi: [ 3e4,Ozt*bg} khN-<'͡"FMj\FGAh1#͆*u@^ #uQ z mnx6y7GGPo'heCpKd|׉[i+:tM7rr\X xp\R N ;dיa|t^k=$xFt$]kΕxuLescijAz.1\3jvs}6נ\UQֹ9A Çyqx%38ܕz o$k:ˌڕJ RNh1kMr+^}S/kG3'p^׷t H{8m.;6ޭ㴇; btqáҹ[-aphǸ[ʤ*ʤD݉DH̨)ƌJJSҝkhzHt:h]qp} L{ A9hGzdˠˉJS2kh0ɭ%{io); #qo[VY hXخ%aE Q lo&ZB -9 %'Zs51 0 d "fHoK/-oDK/@DKGDVYUGKgD/@S*c;-<-*.MEnxom꒷.خ`=?* C J=~qo= NdD#H-zJi*v+x۝o]7/ A/'hCUF=r!w7͑[TWv.1uF {"vbYKzؽ ,%ΣN]0ND@0Ō@ƍ@e95RDex endstream endobj 217 0 obj <> stream xKq 8˙`Fh p= `Ȣ/챍߇X"3g)UR}*O/?oϟ?|}//?~~_Ovçw~/X?~,ެg/?|̔~p5{z:d.̓3-!zuY^/[09"?;}_]V,:>s/zؗ:[)\G¼aݴ׋7yZ/f)cDo?o^o/0{,|X*z,1s)_bc[Wo~]E=g[R,O?U#QZ(?!PЏs=9\̣><,MYE~SqҠ*0,w-.O pi!Ip.џEe?p~ c<'ߝ 1-0ֈl}:"UTQ( v6B㤦Д] 6672j8mƸ }>^S %Q~Mf؃Xu%Ɉ좕"0GZݢXxupSPvuܷza*VQLIF{c?sI]h}$S[Æ`O7dT9v'xsM@ճ>I!n!k~ B3@'`R蓮d $;a81M)^ ~SʣG9'lS<*\u g8*3n'ݞ44͗"i>` WoQ=ʑE g7hV I=_ R>r 3E,WUUqR͗4zPeеc׿nL5M@,deq5֭-@h ) RA!2B%Nҝvc+@hO'x`'!4;9_}O7O5}.ɞލB;mOmB5VЎsIW* m J(ZFLƙEBqah)H=.1|Pe-@mA/wzlEt[JkCSHW =JNh@󚵄^(ib$L@RҀSҮ$ЁsQIR&Y $?x+dTd=P qMNwi6բtgS]=)#?_@$:D1K~:pox@wŒiwUY} wMԭ˵s b{vʓ3Iyn'Mt_? JxoN/f6M4ɼ[p*K=% z ";Se8™hh ihzlMbxvlhg q%8L DF }PEޅn^>e=}g3UCMqH TN2m\8M [Cq]xCBq~ak!R1m!^_F?K9Lx{4~Ԗ4: Pu6 CU+gbm#-:< e~L!+jV$D2EJUD!`#PUg TWPm%-cޅ枱Dߪ~8|T90Ibuu $݅q2\X0ۃE\!Sh4h+@thrTE* \*BfX争 O'w N61*AW%(T=jEnVbfK<{ߍp_%ooo^>9_3/XypF=\FhX!]8 ζ[l0v1:ykӖq 4!1dMi 3qab(t NCSwr66 C@$L]2%7ҔskmI0Wn@ڸ: g 0@IN @NG%]*XHX`wgvItM5%Y6oY*{z jЄàVYp 8BJF΃]^.@XNj: N:M !l:`u;i^4mF;^TUF$qGq5)Ϗ29T줔Jëʓk.>ڦۉu6K+m R.yxJ*T^'Ɍ:\TvKO&vY2.+o.I7xSϛ-edZ=l4իƋ#:{ {I.?XcN84k?0fNޙ1/g֤v{XHqu\;58+" ." -*Ժ!U͞WYT$'L!mBES1E~)w {~kט( AmɇlYh= `3IbBw15ID!sIMJ*(CxVՑZu;+@]eƹOr-a, ,2HbʭI7{Y%q/DqFbJ%j/~+״ oJC;s#K;ʹ}E%bS/O7&Y_$f*E4 ǽ6o{gLp_Fȉo^^5bm.J/9z"\4@Zsڢ"QH`Ql׼"TrEO X$_90m1mF]ӣg*ѲI -LjD h"-GUH%uut.>DLQLgz}Pt% IHrRDEWOx, Fn$pKwJD ̄n8S[JV=~;1+u8=Hy<2ǡ$shr y%̓sܴ˒h۝B%]=,R0mo_WHcT 4NM*MI!;\5LRA6D\m [!Mk_WHcŸy2Gr #$Ag(5 A1;!2fY1+T!x w4cVȌ3fy g̲1Y^3[h$Q1UƬ6~5{˘U^̘!xlڧVU1;ӽYmKuVBJTY3럚Sa >HI.yäY)I>\x1ٮt];yN-fMD[Hر}jԩ}%8حSm(V3alw>5lV,% ZmYNAk,m ڲoVT2b/y!_}`U&ow,PBINRj*zPC$^&*ZB+.>Bfx} AFTg zf}j]?Y[d*d{u֏Xj'K{}̮݈hߙ~3'^]x1;ֈ+R.GSM<ߜdWŔ1&7>9s\v+0Lk35xǚN& :KIx zA ͚o I~], $]YQ.?{6@kQ2''U~e/ i$ /ҩ3 .OƦ_#<}t6W^QW \|L2e;dsg =vv#Og)ڍcS󼼶 e"t2L*)NFԺ!'UdnF_=Lj3~] [W/m9Fi\|4yg6jggv5π&g0ٺhEB] ьh=9ʨJ3H26AY& ,2,o@lÝ6Kp6Q]daOQLc<LvY7îwC\Lޝ<C/,&_P#u=Mi*Jk,rgxd08iwR)E\ $pC)HѲ'A[i`Ύ*ܻ0]C`(%0s ۔ m ;߶b- 5 I  @ GU0npA+do"/(.AΉo4Afոkӓl\T'fI`"E`QCm<Cfv0`p%k܃s;^]_Ir+Q-=E/NM=3,*PGQhpuQ/>i۝SmSY7+ʭlDPF'Mqm 6$DC3ށ]hV\: sݩ:j#{r}`u06c.' IJMCaA 5Y5* kngF8 [2ý҅A')Yš$35ʃSX<i) x?5ղӱ3֘!TMgzÚʋxLohb G镈Z1FSwKŴu"^,փUzgC(Xl |T,6mm߮uiR1mrUu|$>[s(mjڦ'k:6!|.V Oy1qw<ϟĔZ`e۳sS_O,eɬ7@']0hcIǝt.y{)H_ڧ ]OۮVŌ SgMS0+D쾶1yU){X\egW 6NujO8VcDO~(Kǵ i۽lC"Oև1{)o}q"ȼ@c&kOb=l6llh,! *lQmHݎW]ZuQȌ.\nD'jWNܕGtKsue0 ù+WgKOns go'o׫#`aڑ߆SGAΙ%ȸ=+xܤy9:iݷrx~mjkE0<+M<>1_;us:^.LSTf,#ĕ]Eu:ͮ[\D NH95;6 ɨWZ*hU4jZdu؅;k3O/=5 yx мa-Y NLe@d8TvM5yL <ۼ0-;\5KU{ж{t/fYZÞ@5{&kT";;ʌ.,1sV*J6-$(e%'%=$&a7@]Le {ۯhsDD @f\!yJrBV+;i$! Hwds*'ߋ.fLds3x*X jO|@jtV +d^ Noi%:lΦGOdgioh~=S7E+w:ʥ& ܂7zUzURԹt5D'5ClqauN%=avţ5+;{8shn+p65R0_am1Lp87Āo58II86CD2,Jeu;^ ûZ S ax_ e1Lr rEY2YXEyC_U?jح1X83uɽp%@&z*z^/΂Gv_Wu^8 *=^/労&|9!=nt#qWB<)xLۃZ_ ewgOolL>З/ }ҶRf^t[w‰gn 1"Gj% URB0^jWz*T!ZqӍ"M @$A vR!pvZfAA?@hDKl endstream endobj 218 0 obj <> stream x][%m~`y12543$ ?,A}*Q*(V;0")R%~D?_nOOuo??~?}r{^޿7oRٛul߱?OL;W\WÿK&_sŝߥS+cֽg~ۿՋʼnJRf(>L 4|Jm{Iܾ*+V,ڞ8uS7A_Ƣxn#3Fe]o|n& Q0H D--d1*^{쏏(E>9l=9v,jM-zxh OkPykTCūbx3oς7#^ߞکځN\ۅ*}HO"L(i0Q'[YeieHrZmnc;'AQN ި]sr勲7]KיJP1rQ_ X@,$+qg$ (_ÊyNyϩxDh+sk[|0`ٯ^s\. 1jRH kHvHU)Ux &H6SxYc:?uhGu1;QYB0t)@ r8 R-3M4f3"i'BqN·*$Ӝ>JխL}}fnpe^\;q]ȭq'6H<'J<_><۠G(YgEYK<'%՛߸B>k5`YQ*7lQX,z7PksO-PB6UZ'?>ӧsBYjX8W(C\=|pgdl;dlNȻ kg !#-%u`y'V{4]8~ZrG h CczP/OG[dGоK!Z^"w/wu6o֓*庂)8Q .Luoe#gMP:?)1“$”!j}{f\}G).b_zP|)eʖZ_bˊLR%A`ބKY_ *%Ei5_&3Z-`\^}D4ZMB'> jXr8ʘVmYY:Qm6ڽU `X fOŋkh6Mf~N-- X4)];AJT \٥|eYbYks(uzHgN~RJ<7V;?"ә+F%X*“%X6v 5 53?jgPMߌS.ܤئ#G\rxg^n{kȆS0p"y]^ߜ׾Ok7!WYدo{CݟA M|fG"6rE)Vs7m:0$%3A[}- O4ϰs˱3 hS"~)SPl0v/\juZe-$R _ i$k}Rw6>I1fLgRhk[$e5kqɽX/r ]n[Ojζ}u1_qae {=ƌ+Fs^S^7 tA o Njyb܌|@yᗼU`e;$F@<|,: ɢq~>ΏQ0?4j:W8`=)kAJ|7emwňn|FxVNmd6gYZ;DwNs,vVnY/D<y˫ORyVqEez.ega=|8ߗqZܫ>,Dg+F*l[kN&'j #xJECd_^{>*X&^k,aνܣcϏs(,9wb1ȹi9Ü;Prnz19u~Ve51*G "]­ d ˵J<f=Z"s'"{_Eώ..e(@yW 1b:*VyeO']Efx4|2meCt;"9ڇs% Gz6"6X6omTNV.5m 3鴫Xcl85o1z 8t='wn$wutW\ړO#clND>hV?BR)/>1) /^]D~t^<$,4_ߙ2BQtxx?. gO+1>w.! T|zb8ZPhrVrKR2CSnX~G`1EutY80ZFǠK\N!sW&[*T1pfbDpu)܄"ȶS-N5Z;$`jYAV|p՝s*XW"tGlMD>Ь EIDfRUQ2R™`\H4bgjE JD9༪U,yU@Ţ`BЙ Lp.Nk1BߟԂwND˓TpVnb8O&RňRwީTp.ptt 'ĚXՉ*2|0*\>;Yy.A7<)k6*F)&ĩ)&:U (؎NL<\`cU:\td.:U $G;Ť*UJdVHU"BݑCP8"$A.z% CJ@CI'I8BE \,#_Ţ(ZpDFV1u۱Cc^[؛3B~ԒIqڤf!@Mn7"@ F@-n Bt5U5@ eXtQu5^ٮY'.N%U\!PC۪AZS c:٫^1"DWw4"d-@e{t+J[HZ <>gPyBig.'ޞ.$Np u J'O\riqByN16"<|zD[L|r=B5q1JXzĘ *| #2 {## !.$E]#ph\Kqf EQ\h?طEV1WUZҋ&8RBfSbDXSk Exz<\vUp-- =rydضr`Kޭ;̱#cMu9ǚ.< h7du.ZդEt ٯx״߅d6R,&m&>H2{`5Nf3q2>Nfp&&̚wBWmHH̛?)/1phPI Sq&_WJܘ~DH#l&T o>JLxR#P} =>#i>N(7|V>@ 5%ya}u %'U tJBtAա Ё*l{h&XhwI҇򥈩.ʏCr‡mo>aVqܱN N=i ӦKOM^B~lil[0m\l˞ıKS&5W`u(>)&a4i Ow{bp&dJOH=>?R!Rc $VT,ZTSE{A #ՠ\{ 4x{BTDIG@|`1>Bb|bH jH gq *ѐjPww?P4{ғ_ubќ,Ýl5(ƊCOd )*vTמdDxB kG$|Ag'v_8*ȡj|h'}|hgL> dʡ I؝#@DsD6"W#`W~*KņqSFΝww޶<4G%(LJUU];uDGvq l V}¢OXȪiLЂoX4*™N pxw݂:D18ݟ, VT. )ʉVw`A'4p9iU{y8ytt 'ڦ<;y}.@u?Hk 4qdSP~.RULMDb Uq3W1_ P9SD_Vrᝎߑtd~Nr+.#B=YnURQr+LJ}V.U Ϋ/_Q-y.)ͣCB%[Y,Y#H' g>͈\u9^;اo0v@̍hjRJ>)du[e^##QZ JUp.g/u/@02;{t٫Nsfo)fObEi>b6"e>JˬX!(m8wP7>B+usHC:ujg/jt)VegQfWyjvN5l /yF?nIK8v;q)S 8=A6Nq}|hmL gᡵLC9&Pss\n5PŘ6~{:puHI"U%K\,V/Zݶ{`TTRtTj%=Pl٠wi]ٷ;[*_a/T0 ]AJ"#S]%ewBp;H(vq-ڮbDr]{n8k??g;$SE@|L52 Tq9x?+wJ)> stream x]K7r Ki& $ƈ,Yx1! ȿg,3-VW:߾w|w}>~廯?7\n훏/^> ?z\-D_J. o|D|PA%yk qD}U !z+3߾yZS9 .ss_ޱ;^=]J-:>QqdWo*$W}zcEұK?]L>s\. h.ˆeE"?o߾\#bѺɨa'@F\}J?}vuMby{zMw(EAdsaЗZs 5u i ՉsY&ZntO l";=(9F66s>]FtHɺ ŗOB}γ(Ң`u"UL̢i`.ڨ^ <|(-L7@9yVsDvxُ~F_f@7A0MA<&6Z8,Ι.)3g,gTR5 "i蒊G*cCPޒD4I8OP$ mڠ] zI\G=#Af$Vg VʶQ7O&:X0I&Jlm!%<ǍtaCH"Eahtzu3Qm\#@pfYÍek bM4[ܛjMl_&H1=̼jBr"=dNdžP`aRS'aW@"={8{/яn샂q웒hyIy^Tg>'b/k¡g#<=x I')Cx| ~fRƻd67d";l-I\ 92TK#%AȎrt=I2`|=3m *TZ0~R ՍV08> -AoJCY}er sLDDhpf^/F{Jc!jF-M"lݔBWJXemy[w?lzۚ۶`'ox og({wtDΠ`8:7Fg=q3ya"ԉ)ɫUYN75NO+< cȔyD).\$cH%y-2+v—ḛx@DwRU$THS\k#yI(p %t~Ks<:k~Ĩj#?bwF:8tR訪Ϣ}S}p&Н:M23SXI-fQb&i^i)S]bLZJ3-QrrV#a ֮v%7Chnֶ]E:7qV`_ߔ`wZf(uNmNwN<#Sɳ*m&n}HXd'AAbopDvzu`*ݤ>0`{?YuUX^c=SWY J $Pd(QɃC!Aq1V !)ʸA7,l2C$I, Mm23uWIF +9mN|DWN7}7hC>դ \⭺YUQ G&vt{T*f[oGb nߖ Aݭ4j1NJĖJ׳!Zڻ<@qF#((HGg ?X  0ڍ]Q쀢 b'k]lԩȸвKe3ƃ`Ѓ͙lT椪_6﷾h'^0wO~1h|~   eb]ʛaQ@jE͢ u ' GTCpz H7e /Lagܽ[`4z(#ITYev L+c`;h&v`V`iF]=//(CzpKz0KKU^W 8<ɺʋ2!”ĵv*LTy '<R+jK.JAMTLY#Abnh5Y{=G f.%W)f8(.3+r;y,a:7=[Q _tSnRu;<$QE3:ፓs3B5b'Nxm5<0ơycOƩI zlK^:A&Q3UIԤ Dԏ]p׏Qf~lf~Hd&Gp|2>9U?Y ^#;xe]obaANTJZ93h[nwÎ& S倬py3S`ɭ;&bٱةzl>v f3/1<'=XO\Us{ x3n)dJ)Z0s-<sM3>QA<{߂\kkfѐ+ ↱ CUl$q':$A/=Il$=ٕ>B~9`ɴj.N #,pU1!L&ِKa&R\58o0@0@Ty`lة'FY~[GGA G2U}8J8ЦL{$3Q( `Np7WbG/3Q~H|rq(ٞm;Fz=C}p"(r?EЩ$`ZwvVأMz.܈NzS߸nй C؅d=P4; 0XT Aӱ:;]#MJK Q((B(Bh{K \vAnN77˷ la]!]5* ͵iJ1v֔;5n>Q#)wxj?qi47WKZߔsxaٽTۿ{ kx<َ8⍻I}h44";*ٕq^G.۽tP/9 - 1}([0 )P|wty/?m}A\_Z2G7v7M‡j]VeϿÉ-/- qibD59NjesxN#uSIpq5V3kb|`uT_ +U[c ^'g )F]p.8F^4/Xȱo9~87!X>FN绿5Jggxρo6.%K5sdptS(D)m MO\d|1Oh\71.>؟vXuGֻ/>m=ןYVC\FBLM^0Ӄl$T7&U퍄sR[b}Ь$]#K23kdcTnȁ E4nTb/>9ߐ6nsXdo(,Jiݠ}ӾvuP{YQy刻F,vtVvC'VjxaEAY lHc)ۍ'CqE|qb}q^sc8(zK QQ ::W"B"Bp`{_\_ 8̾8Z⨻+Sx$n[ec'V)-nnInZ uD7t=vu,O:}N)^y:B2UuS v&*xD|trOM.Ҫ}*~6l^UM5vv]܃jF{Ǽ,Tï8aE5#{l,/zޔp-z+zǞ|}zq|}2e-< Hvbҁtqד/eU?2=iJTt T*[\%q}p&- TY[Ǭxu &kQkriE1N@ u=y1N9!Ћ/(}غHiJޓ\odܝqug &ii]=4fyJg&1 qYFf򗨎p;tӍ, XJlAo_mrB^mydKc Ap_?; x bJ>*R+JAG>N>@]P'pKHa%Sy-3=HaIU'R0^SD"$aI(\V!mSu-I]˽Dq/Cɩ^lE\X(5\>p86"}7S߉/g=R3.kڹl%P1MRH NUuR׈nڹ/$Q쀢XbKv NN+.EvH!!&c<雼=$g`{HT!H$Ŷh;RSvI_SFRmR&UW39 yHW3U.5-4b[L̊EQq@!%C!G!VCG͋"z>d~VȪWʛu|<%չ՜tAKIJ9βmo۸, N{&uc]jNBХ ZD}v JB ~v|rGc5j[}.Fm(M`}%#ĎZ0}m~"|C\F Ec_ 4Q4{vON࣊Y ݽ\3>t:>Byo;:ȕ(*Ȋ08_9WNSl_8:dwfAn4TdXf*=P4QApի]*%+]bFa`T!U!ǽw~{KCcw# to3.f3[pf0/&s)m? endstream endobj 220 0 obj <> stream x][$~oP=fZw)Suβ az`meJ!ei*##"CJ}qQ(?˧Oo__|?~O_?xyy//߿/ )ً͕U翿. /fPwÿ%/<8rSwǘ&܏|^]2Wkq_>~0wpAPeeպ'nmpfo^1_^T1-՘VKʿM~`WEo)qe￾]U\3uI~w|#2/~ߩ1-h*Kb/_>hyGO/T?ų~ƨ܅_5v&?`j6_ eVd5kxA0ߧ׷x}vX8;v\+/E]nzh k'5WT/0'}y0kmLs.W̾1zHkjtV_y`HEp`e0Ҹ4”斉ZQ\M.[$6\z3sQ~Ţ6-VZV۲1qV̶$]':c6֑}]blUn tn(dcx [3sSzn|-!z^k(AzB]LTc6<628ՁJPNTH6'٢S1 ]R( OޕgЉ`ԪHH=h{qwJZ%y ^Vf[Z0ptӊ]g̋-9ŶH#:a;Ho]Zgvk@&8@#vG)RM EW)Bn\(e%<-2=J[jEIRb64"D/^l0u .Y^ I %Ɯ@a ˛TR(GsAXn]#C"3.YdW-o~hW S?8oMn|#@'S{:vPcPϕuL!v:+_ň3D]Gm WPrQXG}i#e_B͖|mD, CӒG~GphY*! vBIcKҝ++6=Ghrx xf8h(D9dRSΰTB%^@cP X*(&d&Z8AҳeBR2|,a)\װQňU}+bI$1Es-*!JO^ԏ$}L+\Z-f+q`\-쳰S++q=PrGrlKd-9X,;’&*$@BZ16!@&k* UDʘ^6b`ד:$p|ppA jtDsxt XzBIdU˚*`t([BK2axNpڃje`[FȒf -u-n.v\Y*х W52 ~ć9~ ?/5q ѕ!l9,: ``Iɵ%{ xlڷ<,Q} sSWx 1cGW*h`X`af%Hz<04+Utț؍^;̑۵t pE$q1V'`{cGPՠއ3L3U7yZHv]dm°\yQ%+ α#7PJ7,[_"厠fqW"\۷[Frcd7h@U"l[6 C:<$BW7YMYAv kʃ{&ܧv5N~b9dv=p\_cP.(&g&#ozԲ\G#Lys6JꐠBoHJns9kXjv{bP #_ "|oTTUlvbk٨-unn|Z_VFnkgU>_TkAx8>I|@8$FW6l9rrFbZv PdyFص#!H.#X;y޷jkY#`>)t7Ŧr+>Db +<G8ARQsYNexrO7Rt #ߺ+&ZH i/{s?r`WJE9wGu4tmiF.ARX NH>[W]k }y"}@ MZ\DiILy'/#ڧa91h ֓B MGGO>O|z\+>^~iB)47ߢ}3o{FV#5 dwCVkYnwɓH* ͳ-y׸> %HΥ\6) vugG (ix9F@zGt-u DAK@u)L\5){ۗ[”1 ֤#a9M\'`lHe=HRE$*i'V A(ARAjY R50p ڣ4|/veŒ(R )yX /qTzF;{I޶F'dVNrJ}SE ۨ{2>(> 5v7%nѮe-TXtO7=A%*9鰆OlӲG#CqQXFGggP=}@KHZ_!>5N)~/4A`A>TYXdfG, :' Wpy&. m~2GH=vGus)z`y'Rμe'3u@p*gIc17f+3qHbYۃ:rڲ0rzujn!`uuiY5kZW1SF -$!=S$\HAC&;=;*>$UpH*H펇8ARdY %saI"Y$HI0bCs XZI$$ٸ^ ɸ:` =kǤz $:HIՖo]ZVm_)e @=`I ڮҲGtv}FFIbI|hH*|(H*HʬHo| …ZhQ犒5$EHmJs ,XZI$$)ya0HJT#$9?8~P\[ӉJ-nԳ>u>n}[ɷ.\e1l[q(ceؔK"][dkkVkk^[v'" )\(,DntRb|R[C jD =MykkKgkk8>@>RM{~y,!en7tX[K-6O:X[[Mjkԥuk5(ښba|ohyI:!ַв ~Vt Q3Q-۠ tNi Ռ@} tJ%&CSFAA=h?EI=1)cҔ;cE?X"t3SFEFI3bFI|NW1+>T|^XyfE݉*&J.x3ӬT1H*&NPyHh ;> "-s': TxHa7B25sjY{G0y .zxn _K=_h_9ʕb#Dyɭ./lx>}@4gT6DDT8`4O&ROeӲۮ6 M8Xэ x粮tS(f%bpC{aE{f{; )4+G=.`D>R- ޶[Z`h$ٝ -,o{Ҡ2ܩ:QKUX,NH+h}.~}H9Ɂƅx`5gfK D4O% X|T#{rD :C$WNGa}*dZ83ȶtlR?@N.+>?PŠv}ERP}hrl<N(AD_w.Mbܽ 39ӑ<ʉyTB*Qu֙}3W6bp}lUeΜmWN"iv]rRkɳȫ~yHN|?[V |w lc"7"w;IBf)WR:'7-jg;WD7)^aFSw-^[~~۾-}Zg>tJwE #kN.-z&e~&s=CR[J83ѷ6-WI Pv?Ll^!3s%Y9=h L o@\W>OS߀(7$ >&;  +3+wqp!@B6 Jy6JP#~$Z@|n@w.!YoR,yw}o??ֺafoA3;P*B |G b]Lwui7D7)-DLyZ2gӀCڮ?䉖I)v;BԳMzvʭvBi a(](P(7f&J}펖ݠpxSyOrSeGi2[]  \f - NR:6[_e7IGgq\kS;t#2Rб%Ŧ,e - +KpÅod}iK䩫2su[BzLgi#ϩi&xә^5ЙTvD)gSCyN9eVo~ …m~.4+ϒ>|Q '{N:`PxNQ۝ݼR0>.c>Rd9eV|R7?UP*ꌇ>9W'{H~^el_h<$Yr9z=m!KBI5}Z=r98+]rdb.>:Ay0h I )E)=s0BMbԪyqCxaExfx{BυD+@M Mq(0^T3AQyZq=$ߺ,Xi<\J `%vu3uY wTiܩ:yY8"B`wwU~DQ2ԀB A9F4`΅HAc&{A;*>FUp* OIB[)Gz+wD'Q*R|J^JҒbɠHu 8 hnnv-j!)\oQϊ-%ȵ槊brE#WBW)юqz2tҺqW`i݆~~9-{ 63amLN>;IXA.M ;y Y4PLAyI!$',?zL,*PMA&Z|d1yL'ChEwI:g':P̈HE$FD&b78^ -ze7yNYB´|R´rZ,-musꔷ>T-A%J*C>^9׫u(:e^Q&i"m t&#=lunJ|q@2jh!?[ypNh0m2>[nsCݟ͹CN1sMnw>4>VgV8G *\BS-8Ahm{ws .iX`:Tqܽޕ7a{2XAڲFFxi:zz[u6ɷ.-0NI t`A۽i9i`/όDHA#&9R<y*V8V8D:/LL "]HEAdi7'"(TG7O4YܸDDч endstream endobj 221 0 obj <> stream x]ݯm7/l4fk,馅5v}w7kJH쫛wE$Q.%ND}uu*'qXO 7TPI0B!W"^1g:P7ciûƨ#*ȤFܫܛ~:R%vi~57nnx32A߭!!~( TlgPэc&NfńN~Hp|* {?6گ3~F ӅF_ʵC[N)*;F8K@r86h8W/9&B &W?Dw&q;4[0"$gqp8%BhCF钉n`mQH8l_0xX">LEMѮ(z*F ΧFu t NA2uul;0^ݪjD sȄ @IC" 5Rp.z"a| '0O9N%aG0fkLAvcpc$c22_w瀮G-udMu$ 5Io 5eEut-laą!ުoox̽jİǫ/g)esZy88d5wڟ;WgC%h I֞_m#)?@PE C 9qY#9cp p aqNWw};P7MeqOA ~f ~f&~&&~YA 0Aг Z&b(:wC5,A9 Rho? 2gc0zIYGR__5vuʫ&G .(zATDÍ+nU0!(7<`I+;rtt;h㧉62LِG=W59^ y%I}&y%CZg@{lyEyLpy%|pz.# 8<(8@A2(<NQtLJz-Ge[%_Cb <:u6ݸȺt EEX. n }rjBOj&KI}рP]oc@7mx7W@Tr]r>^7E'~􇳁kQPO =<* K'zSp"&h Xp}|f#) Hp hVR@%G~YCK/̝RxxLL$<{,)sV`y )Cɨ71XSr Nphra6LQ-dsڴ{&^/#  GQ<,0}=<+3I2M Yt0(  YҖוqɣ[C2PC X u&ԙ P'&@BF8uv 5L,bkPgM6'FTe4qj˫`"޷Pz* %e=@ h%^U/0تs u˭' =yBmM %@VTaS Ӥ>~ G;5\rKSTAbf<' 2{$WKfߨٍ8++*x긿HLw/+Gaiu<^ ؤ@P7 Z@Z@fQknJ-QSt.0E *ԍR'Q W IO\!7ZhN~&J hN)9`VKN mΫ =N h)Lz `ld { Ҿ=>k0:62 ԣ`_H!ѵSlPT>bSSzlETzI PY)ի1^m.͏oD(ʙ"'3QZ'ɰ>Z@t&J8ZT,FBx_A#FOQD.[)ޠ+[);st5QpOP ]o)NʚtRBa\j |]h!K"0;*{K%(,XBRRfRb1HD3$%,~c G; 7-Iyչzjrq%N8FK~r󇮷?-8ެإ[,١ۺSi]ړ=y&ФiO}/wJK\3zzѹ 0Z@,,3Gn~7mpi#ZSA1XMQ;  c\ * LғK`ŀ&(6-lھw ]s `EEs>gr-P('e}GAq:g;O[< |:ƒt /}%/U:\he?R 8.@XG _Z+59t@KFY?25xhesIkvwc3&|Gx|3SoP7"5SМ"#¦XiB3l1B+x1;BAL3R UhZv%y1Mk{RVڎpɥ7T:*p%~F;>ߌ#`?@F}M4SEX΄'T# 7VR0M½X%t\oj Q5S}=p܃ިpH@hB<0C /'^6pw @ hTt ׄ1Mtn>@eGGJe/ZqӾtt4ե)iaf-) x!j RcH1pL`EY`dȍ0Ah[nhLw.}Lz\, soh<5 OX74v-}h7V44[>wC:.{ЏLUV.4nXʮ<274P:XћFM }j׍Hxയ~xti]ZKgbpڷ5+-qoknI!PL`aƃ a (\MfMtȕQ|w]P@vW3Zw6[vW3Z'QլY?uڷ'X}OtZK)}0A pa3 &ޥmLзlh3,iNї,3֗hq9yןa;@fg&oE8X|\=38T^4#O(g7 uB#zT["fZh5=鷲8+KYwJXӓ*4+%vV%tݏ"@MkBtrM1 :e/@Go%or:ʱL 8JGK\1zڪ?Fg?3xha1BO|9H\vJՎ.0N׺ꗌ!MHX2ʧpi={nRc=1w*A{ >Ha 1̬0pL`AYj9Cd@P&(P?-{ ӝK/C\,cȬClB]1l@dĈ4ƮͦչMa[P4n!PMau Tcˮ .s%J2-i IYi9IF AjZOZo9e~QNÅد"wEW_)V}458aU.pࠨ*&OY2\]8Y"@"XEQa (\f5B:u> p -@Lw.@bEYEm>ӯĚT.t.zԑ, 1t@ĺHL.cw$G@܍_N'(62/k 2ctߚxB`koZW8zF @s7}==bCx+%%'7}$,oEcl0&ƪ-w'/r ggO\͝>,*Lx%ٿT_}?:ԝ>:~cj1xWЌ)~~O?x_qwi(8xi)HPV8r=[E7JpB]`?NJ}П),OlTs6΍=4'b{~@ aX?SX rK^Bl7;x,Bbv^q)l 2ܟUx^Fe:q9 \ur⫛{&= d ١mbw| MT2ZJeC>5OΉ3}NW%k2cŌ4ǭUH-fvs=NRٱ_D%axoG">F9رo2ZσCU)O^fĩeւRf-Xej\f]h74 ^ de]Q:-zCK@4KNt `ÛX2Wp̅.656=87✫\b;E]5EшB[ ts8ӭKyN\v|H6t7qm6v dk?yrooⲫ H6v7>PD*YdalRsA UUP\ `p&2ʂ~vRz4܌7.a@MT(֚SK惛 9 .m{r $_ȓVJ;!D>;0zXN7ۜjܴz.964pAB6KtMT`9^-5nU4Jg"Vl5猟xAu$Guu8$KmñG6tz.E}BL\FmPDzE\+֏@ISwznysJu~ .{ߧ?{[kϴg%K'~9vPo-h>9gpoe <}\OEGV\8ⓋTsDkPXNG߃bREؤpW~3Y! qy (\|Yhv<0AhE&ݹoݸiNuU"{uwShp7MbihMOt /su d_be?L'O)j(qE;fsBlGF /m6' oe~hu70~SD6.m6\| > stream x]Mx`o#.  `0dsH& |Uo)V.d*=$%J?ۧO߾??}_ӷ|{Wy[o_?y-*n_e?߿I"EgoOڽHaՋ|ѫyBYUn_ϛCq?? qnIKdxbA>=bVŹV[?>Q,buB]b-u/7γvQ77Ͽy>1ӯ߾7ʆYc[xco}ր^4zw~_/7ŋ%(xmĘu &7X_Q xgZuagM9"C. n1|$_?i*Dx j,LRi/g^|@A}R4aZ10iHPbXL.,^ϓAgFF-^jfVuXrӛyoorǯ8a6W\iD 18`io i5k Y\m,uF]lrY.8a|ۘ&dz%;1oP>el8ܼ[m;쳧>=%PS xBoZsB󔯙lL`~U$8LxQxW J!_~f3#8޼_`:8F j8> Dc ǐֶxG =ُys^unx:ct5.wEOމYuF)쫰"'\ IJENOFNBG 9: ];|K-3dPcMjIɭ`jKp8 d f /AɷqJ7:.l2*x\i'顖<h? fds)j1}Wlz/aC% x<y>@n$?z6a{ ) "4ID VOPEv6NP{":P >ТۨG -DwkqZ ށ_?%VGznwa=b|fRZo~دBLNJO2?: LJZgM?"zi IDXa@KnsXL2{؛Suf\͆Œf_`9sԙ3d<]hp6f"H́`P.x?y{SE"p)?}Jj?p A1laB!g7kwVyv)8RRmek pV`N"fFn3jq!;@=7k!et6:(&F*lvVǣDD zp!AtG{cz:$pnV#tgH4Gh[N 9mC FPhM>H J L wNQl'N :E9߽#OC q9H7r= ER`<٤EK9*~džޙ(q::$XY0#sOY@IJn].~kdaʤ0`a1zx8aCyA288_`8`80'HztAl3]n709v_jyՔH*WhAݙ;>_jh_2cK=r&U?(SrGH $¡4~OW=Zn?L-9z !Lɪm2 . _&ص~lՓ%.X;^WQ A Ak {06_x& J!sCѴrW ngri83cA 4:.L83㣇%Hz<:4xmӳ{>syfkG/ ڦI$ Ae<=?6gk7,ZhI8Qa4 \*L =1N%gv̖XjӆBu@V9*sE|N(wpL9T'ːb"{XgCC9H #禬iRiكpb9/Wewas5Z ~w>1󃑂Rl*CI~C+Vx~'H 4(4^5ZtVoN5D*NyjrS^+- .%RJlq]8i}@~9g#$J EBNuo\r2( .F6<6- n ɏHDxQCAZ-4p(Jls碱:jȠ]gҽo?r@Zv㍬hXx&${ 16[dki[v$M"rP'XN';! QF':!-UtB jq*9!Lw'H ڶpm%MKTH"b8 Mvu$&mŒf/9 Vs@8k$:)a] _R bdXUo~$6,ɟ\q4>Nv4Q+{%XӘ횶b}0a]}6u4ZB#`uҁu}M8fuz@ǎF\}pe`Zʿ ƷyCZ2pPLr ʕvK(|\BaE2+<= *\DWCQh+j:J60k8A 㑈f+%㬟Z֬Im15u@`*׬7X+s. ٓ:NS޴zsj+-ixZԮHbg}1=ş;ߧiكL|wkNwH>5}ߧvR)hT^'Y!bgaE;N.{a-Q >Q>#>}-Y4<-LhO.q!?b[)GGXga@=@@ֹ)k } -{߿g;V58@Ӝ>3`έ>i2݂CFwtUss,teٺOFdfu (HA)6t^^.rw|#5N.VBKFE2f{Z j`Drh e6 [,{};˛X2.UY<X\ 8VݿvV_*j_ ׷߷VvJuAlֵt=O !ѭ`yҁkŜ=rx ѡ/y R|]:]Yƫ@@="t$E&)05~n RQ}ٸFnNXfHQ?ԄkЕD\w`Sr_ܥŠp2+]:_ …]/4x%F_`b0TR"!h-Y7m6N%}2.)aO뀸KP Q(Nz2/t$I2À>@'@g䦜Y^PZHdReCINNZ*_av{W9t%Kp. >EDT0gB3O&eF 7|%?#l#Βb@^g(|uŠXgȬux:' Wh:p!JNv{sY}qAQ#|**~lOI>ud1}"y.+WCyEUswxH֌QJ#ogN)yVv]I5rZYRi$qxi"%?\<.K՟=>nY7KTGfަH>4|v@R}挾RaF8ZI"i 'C1pv Lk&OA)hGbSy XHaE8"Gцl9lǞ?1&6禼 0NyyYIٮ:t6v9`=ȝNbt+b_jgU]y )~8-{<^2fI nzU0O-3G zbuC.3W|e\X̱8AR g*jV0º* *MD ,^rZ,j}* n۞)f+">KH#榬iO}ͮ(P?X{2]:P^˴e~p / 5/a1ށOZv ~ayBlPckmoaSΟ}\7$6AD}`\ȧ,mS"xӹU\nfUEu-bVdVND!(ARQHaE!]ǴJPO$b^[g3+)DmAWguu(Qv =}>?@o(>s>>+8P$7̠Z)Qz?o-b +-qZE"2'4x_BA浾KS\A1LMRiVPYXYy;IBli1*MQ 5dF9dj֥,bIȔnߵt2XOA&PR¹djp3\?P) LCL9H7L-)k5R}\]C4Q0bknFϵ!gFIl}6w"[COaEOfED$ eN8$"ܒ>pK\ݾ b=@%u 9"t5:g)'8%)7eMR;Z.?8{O0b@,;wNZ.]AWi;"b]CdX; +|'Cw< V@4,8x ""^ *rSEMSAՐkPBбH4c}ztK6VB@e"&L 1䶬r_ l^߉lޠL*鈏6SVCbfTM Rd&z2tTE.*>DTU£ b'0KP$ ~l!b0%urR*B jD 喬 bŇKEV@-:z/rڸyN),0:Z.,žCt ʀrSV 0(e`R8K#Fݠ<=Bk}_"w[*tE~ *>DUƒŠ~'( )\ *Ӱ(;XEJEk^"1̬X}6b.v耡PbCE)}OVɰ҆N3Hm+uYVsEqW*Ub;lv=FѥP:kr ̥Tp&Ð\}|f-!u9pyҁ :;Z6 ]My\IEXh51::'KAY@!gy@.:"bf-!=bZӯ%Ҳ%ȈQ1b8Ӟ(˥':?TL% A2RLuI\0=s̈#"F?:\,ͭ8AҶ7ͭ5VҪ y.;5d]uRҺ.k0<$PSؾ'ڛ V>;MYxB 9p#h{) {~0?g{Sg4k֌ c_0nEu#FZ9>M]'#{9_nΡE pΡEC l{ѽ཰"=>; )4Hբx9'"%d0%dv:*+ȝbpΖC}414wnʛl7-{x .m)u™{WN(-q+ZR>58`@\rk<-{@#W!!aVٵ_+,q}ʺa a6R0KI.cClŇيjk|fJ^ip5!'QS ;'"X=E`t B,P>^ endstream endobj 223 0 obj <> stream x}[&mN%UC"AYb" ȿ_DRgJU_]|IH,!Oᷧϟ?=/O?~_U>O?OZۇpO~O_ga7i&ԛyu[E7)6&a^w!*?OŋT%[.ԇ 5Zec<qҼYm={v⦊mzX[*0&CVi;QOQxoq<$=}קO Icu7pƀ[5xCUڽᛏĩӧ ?= PN̞ϟ|>vFi"]7^WbE]Hp_9;ʢm٪X}D %ooz]mh܊58o3 4hKrR?5/[ __LOLJM}ޣ2w_Yiׇ+F^Ͱ>H0Hö$86ΰ}JwIu}:b/yt_$wy;gf*w_(='g4"0;C.6{Յa܏@ V!W!wA#w㟵禜ڏ#e.B@=|5˽VouW۳_g/jr}HaZKkXdXgaBf%PgfߍSj%'* lVp᭥VCA#HN0̇F>?׊RN;+NY+L\ی,[R=Bwz+=3F gnD[m'nI>.3˃?>/,~?L(BjawDhP 9hZC!,1&$nhQ7Õ - e!aƼ32aoC|ys=uQc؃e=W֝8ϫt]mʐO\YքQ^r/7ŵZG7Z=WVsnL\-S2*S3W{z/53MH%Ժ3$57 ۦZ +UyH|zLgnЬAFq#9GL$O<1rb20͊1 7+fѽ`t?X>zH3Ɣ~VENd.tɄl٫ ԉ|WD'BYfݼMm? )j*žҌ{yx(d@iq0QDϘ "zb2b{¹mu@vg;i>$9ѷOPZ6.ꎷi"|^QDyʔRъ:z^UGU\B 66{qX%~=U OS`OEp֚(e é+ytn{9QSCĀ(ҩηߡ<Տ6` #Yh؏0&&KLF!v;ǭC鱲#t17JCAWB,(c&P'A&AT"Qv`9I 86[Z^g_0_T;?,0re!(1Gz67uɞvBwJނ wW+ۗj(y2> ~C=]`IzT"c}oEd_ O}m4f&6/oP/.89<5~9ԛ2##!KXk\0ӦdR|݄Ɋrc?nvڬV>R^Z-ۼX<(?RoC`p6"g#{vl>R68E~>!):P44%P8b( Qz Gfe7#9Q^,~*n͟,݇C1A5"cҩU_|L/Ӹ.+xO`+0/_%z݌b2ɶ뚦IvήFIDB}֩'%fn:~ τ;o~ ćݜ aTpV,H$N=dC˫2Rm_6Warr;&>W8Ѝ>Jsw+Qf _ l>b8y.yz.U!‡dϫXה ћ^T*e( s6T/,o_H'+ 埶 l&,Fs=Ezw_jfT JptrTx~~F޿vMN68P`"t͑T? p0έ%2/}\<>0v3 :|֕[T&ʆ B !g9R*u/9+J*?w9:\ѿ9gg 򏒁v(Y_JL^US$${ͫ||eݹ4'~wخA+|_ )Ė^H1tXmcE%] q9\v i9>eE`1MU ,KNMm<0|veDaq]*F mnjf$u[l<1QKawl]DWR*X$_=p̓%T/~e]5ٺ"yp֮Po M^YW6j^Ϫ{u; ,KdbqZ`vIyS>aȚoEMZǕo۳4ƹսȚۨk1v(fgnW*.eWnG<'&nGs!bs $x(e"Op"P '!z)~t8 q3NqtШmW\̕Ts kj6ʁ(p>ɱ:3>Ih:99#&@d͏sW9* Qt;ԦNïBK?AOP|`yyHnwkcJ=*&[P4/}ٰ1at*2n}T>➉OXY盎ϬZr;C(+)f,/'i*9~8&O ;t䬎õi3X A Zl$E`?p|8> kbԹ %F6<]v1UXKZ2}SaT ܋]eKVK&mST1҆j8f A*҉Uܧ%*"+zDx`#" d%ș"*HN.ܟ-MGܨ.d<Ÿy;R}UЖǘg]Yq%n:56S]@W#+{ʊ)kDoҔHz+du #x݌" Z vGAϩ*P.h>YuwX,-dy[> { ggoU (7!JBTW-/yʜ]MJX_,I [<~q>&@rT-#oo 9y0I~^JWfj1DP׹ >w A.A3THΡɲfCyYeu;oM~ E<~-M50H:~r,_$Nz)eJq[t=JsB#l5eJqr me^~UrZr@OW"JSTpZU9+˱s4.n{biIV^:'q(lϢR_arrI)Ne3JjjqYg U^}Cl Kp#`;lmO( ""Hv3!?@Gt} i_ʹUqضKRi!4DȠxz:2&.2_S$/ϓ&8U ]<sKl}jcbm +!%vдt  F[\ȑ+Ww`B$6ʕW.H\WV|kdPHȒJIξF7..N|-/ P+Y]^~|[&;^=j}- MhP[sȇ[* w (~c[qp~O!XՕ.RM[w׉(;_}3vj]PXGt#Ë{ҽ=J7Mږ"uդmzCx[>otb\[Ė5 .z*ECiaZSvUoZiarZMהn-gvymǵe8ւۖkuw [-ʞ˞I ' XpaT'.p2`uN;ɐSc8e"T^ZEiNX,^8,ScgկcN $* rJQӡN :&Njip֥sTs3ftDd99yXH4t >vR]nX#Q ǐF" r-L{#3ht!$ 0H]I:U%Zw#ny_uYT|(>@~v ݊VGbo{6բr)jcmw{'և#Bq@5#j QZB 4ʧn[<''y+/ twYz*4+2b3"gX36JޫQIsᩍmē[~:Y,+ ̿%8 gL֯Τжdkpգ㭟OLif)XuYTo7`7 H׋2J8Л6J/"KX@-g}`ߞGF)C<⫍ϼ{tAQ :3o;POVxۜ*pnIl_2.|y# 8A" z t2xYη${wazs@dS"B c.UXLߡ̯R@6c~|o!ROW|h\MYRo=58{"ō06]O8v! g -c,)@pHD]Kktפ|;$]ZK@|<p9Llb}\?#?ZXύُ/y}$XP=A/%>qGkDb! O%!˅DwP+7GWZ V,j P+,ZA.jeCv_{+càVE8!xm.Q+3V+']ʶ!e "?p\"T/"`P CiZׇ0 hXV"40 c ̳D "B,'f[D<'p1 = ,2( Ӂ# j{a4 haGDs,Z8 e, vt,sq\֢9}B1*5Ž׌Dak-Ļ5Egx1GY0-E5PaQs&eX~t;E>oZaşU2*nhbGJNpMY#Gm 2ٗa$X1470"Ur:{[W i-+y w([pG(YRo{eC"\lۮM{vjF1|ךSr:q[\2?^CSnؽtm&Fܳ;.t8>F '4S!O",%Tʮ;JyPu˫NӶr:hBьFDӱp\2|{I4+0|{;T~Fgv4Z`Q BpQnXy@Ce~*&`c cLf+~5~vIt\:o \7}v(,+!FC"c0;tqD ^ϓtzE2>axw]~=gx:wF ]y8Fd0 =:t +3>/[N>[_Nn>ݖ@QGo1<0.!k{CɥPo:=xnz4Y7g x##bloxMxM O/~mK H[:BYHIu1ȀފǙddɷԁGg LXoyE\pdroq}@&۹P}G2qAI$nf ȤIGC6TK dRεGl,%IzMaD*BqJ"CN1:)7Ptα T:8Ȅ۫tXNl)Ce*CpJoS`tB q -%DwH=EscCcbpU~y, ;KѠ 8r>=ヾDUsT]UB;^ H </}eQ%KvU7wYR#ѯ?ynMAlvvގwEa:~ͳ]>V\ԇCV>&E[8x9*9vn;dLxnK5[-#cln`/5t>W.y!dr-f*3<+]pЬ}z)Rұvw -#{^"\k5s5]>~`#c~OŃ[ : s[.yE2na\3_[ٝ"}nOh0!RO*.(o͂dr{ ʯ-,Ouʸ}C[3gDZb;ƖGxpKI>AtL/9lr-f@ ng~jPъF|Cf+~5:'kW$?Zp[eDV - '|N$ywa0<[n,etU<zx>+;8Lj fG>st,.- oD Yncx#=Xh`l`, Kވ9-BXwB=[nXE׬z3?5g|i>0陸%N؜re-7l`k'<[YLM h'"z+ܒ& -e^;t-ʋ,%R [" n !°.3$6%R ';a8)>ˉjnp BxNn8p9 X xXDPV''«t.!D3y'5C&"CXF LOҀ&x>ѭX>1,O'L2S ܂]r&nY/c KkS8=ˁ[z bRgឭ aCӨ"tJi03)؜?t X J#rXv˫K=Q1X F1bMFUˆ_40yd+qjuVaOGfA,Ю!)ogv.6oa,ݎ+=Qy/ X|+į(nTX+-/]bn-/]_anڍpN>PEθS܆-G-Tk\2yudkpr kprЀьB,pe:V,VUV:Ϩ(p%#g-GxO[m5yml T'7G 8eO+8-T']X̞1q]~uRrTCI,E)-L 7o#a2I m 8Oҧ3d6 Oʯ̸6iE2{R~p_'CAp@GFx})uAKs9=Quls|UI),eOXm,:i3\ivh6xFl %UF% pC5A޾Y3Y3ˉSv Es{ OX  J·щNY9q:;&*!K`3&'X"#R`iYd}hα},p+z }F,Κ7_ $G&?2u(ڎ'H=CwY&BoՄ(;SXr*m*ϭ梨UWV|^y6 76;=v~tZ.2?>O'1>W8oV*=c-a:ʹb|V+q*[1gʺόf]]A=Ne,P=}䕚5(2%> G˹`HhDV|?'dz~Ta6WҮH.F_jD򧑷G5cj }Aȏ<> sdÂ2_I4|7$=3j{Nȏm0]KF}F%E3𲃓Yx&8zԙR{t6}jGJZqN_UonTa|+ F^ ϓWwԜDg+%:%k?ݫWȲ8wV/CQ:i:Y2ZI'U01KIKK_=ヾD̏sdCZa2$g9uDj D t\qŅH7$y)eь~EGf H/_U<]o{''> r?7"OȥP&h.W;w ǨٺI(i&ċ*?2Ro*`/t'Jnc`}3?}qr"v5^cRjTXJ:  ]niC $< Mʩ5ʽKfk`eUoK[ӭЭ/T"Bd|̓ٚVUuGXt eR+H_=CTDj[* JAu.Rye9Zmel`!- '_vF oZnMdw7p?ˌķ2^m-ᷩu yS:B%cdnq̀(G|1֠G7~%.V!B>mEw`mT(׭AХ6p7#;!ˑz=mB6w{/R<ϑ q0Gf<򶠛x0u"(kGy%5,ӵǮ5}7 &k]QƩZM|^ֆKqG"_B?K}{x}H];K(m;>zNuf# Yו!O5];|ީLq3*cobEu^0rzfE{+noq]T|Wϻl^z]<;i\+hʠ]KPr&5E%#d P2@I % P%6Y%(xS]ra ]@ +JJ%x  f6]$)A@e6N)%(I$ҹ>„(%Ӛ3QyQ S'1!~?!.&"(D'}xNtnh Cx9~:dtZ]Yt۹n5ZcLu9xhL2:ِd쐛bGr=L{r:("dlI Cniyy^ڸ y7p "aI 6+ q)WǮUQ3h<@+!-/a3T(WA rnu?c܊kT'se\+(h0u EU9x|2F. *=|'[A.>9e|*2jݭQXӁn W^U8W&˪e8lQx-" r'CP`HCY. \CY6Ts+ һ;cՎ=AzwflCPCgRMӐSvpʊ;>;t*Ax9)AXNL;&Aݡp.K$Ow 0a$>EXh͒|H9p`=IH8.J t Z pCT$k~ U=@rtar.UXlem!"&ʶWB| m&Mc!>@Eȇ A0e#=4&a@TpfZC' x {:a bX Y z78tMu[_r"rèu 墢OiPd]zY#:-v5EQ/B8s" TV63KA W#_9 кJa_Ba<%{2V0v ^tW4ГK!`n^#`h*d<>)qk[ +7f?2&,@HgAX3.ٽŲ{]v ][BmXCuԗ {1ʨabd FgxAL;ZP +zvmt.H5}7\sAOb7[܋ʠ'#5Yc:bD0ދSS CI;Zh /C?ƌ"cȡXExz:nQ24z9d8q2qEcA2PDN`啞^7hJÑx#J%Ǿ\Yh!7+=ѧ610yZYYpZM(zRdޛf.SPh/N5`wv5Yқ0BYt={|b[Q`$~LhfCލ&1wvpERGһڄۑV22D`̽T޷#' dhs AdX4li6_mN[ZM-HGYԌbdjR !^bDLbyb^b;2R7ۺ # SW <{9'ÐOêO12pmT!ܙ'(F'˯ O1B=hhYTɈHbD=o5?`^ʚJ-e2 W3GT6FH&Shɂ k#HZQ?@tVͭ$'mb^8 z=&_Az G +?ޕԆ3 "|Lp;v}òN"MTاZ,rY~]߿v%V:ƈ~.|h-yBhYQ<!CZ̶xۑ)1g1c9H%* jp?3)r^Sb!2এYз;+ ֵ9vyZ`bK`6V<${s8켆=6ǔAs5NVA'7%E117d'n|l(~jXu& e.P_)  }SjٳBX͈Z:SE`\ۺU>zS'y;L]ڑ|L() ڀIZIMdo<ZDK =\ 4rzd~\EDCNп(1#}d-"LPU`j;d't܃mjXu B>Ԏ"S Jj{6\|(ϟ{,`ݸQ`+P#Lrd'p܃=OU" VanBNпk|$!G)c#rb j6)/)%SdǍ# _E]=ף2+L"'5h?.RD&@'{= |̩%?F,^=H Mf ZdyKVdz<{aE68^H &߃)~"N"RzWdc q)ӁSV?O~+ay-< KN=enq*O)yx29haMmK^08XP ` S02 09Wq3#GOEBb!Jm8Z>)hf'S.L 64)vM3탖G-8LstN6oXh߲ 择hײ Zڰl_ endstream endobj 224 0 obj <> stream x}K&ɑ徠]V5Byo0 -(H=Zjj3~",R 3w3s3Ͽӏ~O?o׿oO>}o~2ooƷ6ksx/7oOò~˸a^?o0sm=2˷y;;o]_~lo˱ηᵓ_o7o?ۏF?_(:G}Y_?uM3ß3ڿϏcڟ^s8qmp4)(b/O.yҷ?m%ܿs;+ ML[iٖO*s}oqXRA7c+X]:C+XbJS5*js*Z5Sg \';dGغybvr1Vƭx(KzMûw܊jGkڎ״%= .j^K@p+鵌Vaza\;SlU9]1:{9ܲ,˔֣ee6UV|xۛne (ϖN,hn$bFlo0UV%{(&Y>VP&&oMm כ"vvmwZzGX,ʔ :ϯc3c4kx#6>_c.hcQ9y]ȹk= qhOd}\Kz|CWzr_`/yG_`o(p=WS=L_<-wbFx aLE ZgKJp"y@9G4zS<@' r] +q?~G*H5g$;yYwcǽ YOǵC ~èyd|˼T뼎} UD8Ǒ0 ۑ' H-z%ݝd1^;BKx-Db$ O.}їw=#Op l6x+:j1`=ퟆӰچuƏ}޿|z>-# ;_pgtyysۼ5s]}?ן74t05G ~-pW.O1^ S|nyz'}B" )NH { g6 xVb" xF|udzsmUܛ9TY/+@%'+p nV~->[ w{q|eq;Vc5kX8&]oV#q?u a{a#<港c},UV݇opĝ>FqgsA˧y[5Ԇޗ_g}!B3ϡa#!=k}UVe$=Y,`yV/ t^3r8]NtU^&þZޭ~Nmix͋z¢%/ Ď oNc#C9ywu=PWjf-ˆ'㋀mh዆Ҏ_u׏yxUCwWVe5k8?ȳFH`gpeלz.wŗ{ɫ2̽9a_^;~լar0"`u')(=sr0sMj>\c;=gט͒yBx{Cر>q?B%x/x5f17H 0 ~*Y sBB/wnTvNV~gp{f&b ),$NoM]qMΣm *BP6Aż *|MP1(37 * S`THTGyKǠdA)a=:baTl`cY@.0!aT0h!\H{dx- ^l& Iވx=@!Ix, 8c =!8&)Ij=nʶ-N<]<3eAg)zάm\4̜ sjgR"'EK>_u8~9NvLw՗i}7sQ5cLr5 [ g *~~(eε3{wTlue~(Z7}f)LӴR!_K9˰ulvBAV[&Ϯ3!˔L\lse8TlD@/bǚR Y&D,#|R 2A,S4qeqe\ܷ8Vxw dP=$xa' {–!Y# Yl>=hhe;:@D q#LzS 2qSL|ĕse[|}ۧ,J@*Re91lwtBˁ5^9 ;[܇TLL^rJ-2 e+(1_JOLEqcE1~6Vl!b8Wu%vA=*@ːӾGMCӵGM3{&6vbG^y&"vO( cqgJ56dtD{x1D,o,K ,  vOŸRzMq5=?G䞾+1%vI,\썁 ;f9t^'x|D 1z0 /:uVk::o#rO_+/Qv" ʏ$x=m9e<_+K^u3qˋ>q_2MK~I5+^gLgrO_2!8 4Q) tRGiܷrsqI5p|z맇lG<=vr[t-6Dɺ_Ht&"3﷉HДM"@KTADr L""!Ge:EuXD$H@t0ԡalB ǡ\_!Ja5"갈H`BI]hOvD$C+pcJd,C e8H t9\JuMDq C3HBNcXX::8DlgxL CW9{@ı9 %Ǎ DqYb*}f8PD,(8 G/z x9B8=m:㲀)Gw(ճNá-A#mڵx]l^ON@:mZA2 8E2*$(GT@z2 y QL;:g_Ws@?J.u{mDD '-a&v)ӟF]2 ;\Aâaz_e>]c=cy[hQ'hc{is=C1ӀoiZb0Kl'4ye!]>"bw{<l4͠^OOGpNƠ8LS5we>ʀ ]\S$2e>@E}K=Ku I2+{QnFtCVvQok^Te?upViVk֢ :p+\^z=iۋ}Op|_`miMݏa;AB~a#>bt/%jGmIZ$Ɵ-a> }/%>bFQ/jHZA4"C1EDyi5NłP7[۱tFN%HlrULS !Vm.WنMU:b!W >9f:\(n[)zZ̜ b>|6Km'zk(ѓG8 vQ\{&&pi&f=]m'zg'}_EkKb\tbwZL Yeۈ1=:wf%{ټab/.aT/P"_Li _#mqz·w :3|1SX(Gt0D<D+B8k5< "tZ᪴,y؆ (zv @?=҇"vtS| UUOjLx/s H@H/|Z*|38B)PUpւYa4>t6l>^zQ?iA>s1'"|ଵPh{)Y=z" jB=%{3WDTF7샎'k_Tk?:/rckGFG@!is2|d:_N'q WX`!|MDe`$%e ur8(RUC~} e+ETJ'BjIPn@+NxМǣ䡌"Xx8`PJ'B{<t()Q9aZF8\m;^ KӖu$xQ9)ɧ>Z1PHTBPHT'Xg$5Ib@Mg.45tZbW;bց2~<_> &f MZ?9%P<Σ(GR 9&$%xH?о4 S뼨m^,D[c t YPp&#Qc4N+G2\@z2O='SS|^H0*f@r.Wj;Z{ YOoy%rR:n`ml2o,8;7kLR>+e6y)Ey׃Im o"gg0$ |J,~^8$;{ЧeqnHbvLRn [JXi%=QΜ8Z3qꍞyϳ>e=@ >YUE2ulԺŽrwR#$-3 wR aZXj _t]eڣYj}W"_e-J;~N_)QkY~^eQn?E^L2# KXA19x%'2CM_>92f kɝG\*-kZVw*,c~ZGv1?/JMd3ʱ# z?}rbmI'gNJ]_ &d5=A%r=9!3ծUN U|uH 2kEbOx m y!oH9FJدnƜD2cY"鐌*紛s*̤1HUYWC= 3_u2fM1g3c~IaeX5c|J1e wb ȪAZU"UF V TnVHW)[f&WWfUYTqݬ&Pf59^CvG(vc8nVNͪ) ڗ2xyQ\MY/1'`v2, ;LF2*cwz8GriSnUIgbi&(s9otF.޷KDŦ ~[aȄ2'ߤF4`oM;dƒcv&3X>(dz2kW k2#á%H&7卶:;z1ĺpr r}vWk!m#A$mEm66k6RPņHWXSjA6Iah1K # <yaDICpP,7<ذ0krbavAF1y@eam_CA ocStRQu@U'/s0B~{ew׊qerl{@Iy-ft]<_S`iCl:w:?> ej3},>l๾aݓZ,8?'پFkI|ZC<({[U530{Y!&n'6@5BI}sfGQUeU3P{'Ο,82{2U3{_L *vhdߴou3|W6Wptr O7-fl!iN^x7`Xc5o8%Q^lUj;1HNZtB#D~,~Y2urtx/܃GC$:FbkatE EHZ-25]G0:((cO'FU`V"),5ɏGIa I #EXxP)aMBM<&A,h| I_ƒ' b]pL:M2!@@!ugFV5kKbΜC/!($ qc!Ni($٪BKBX$5If@M`'TL2u` nY_Xnh6Ýx*~g?WY4qN_a=*loqtP- `ިIfPӮ=F1MT{I5ӌ?=l7.kjw Mv8CYOX{aiBG5lt8x-zh<8jUPB~7)\{A{2^=&F Px|NP{aiBECk,@>+ h Ë́P` 4r/= !TFmQ5shY~Ӫ @hAAdHNP{AǻiFC[4]c99^ao4=/ ܼ ǁ ^uWW@W}W(@kÑsXCia߻iBA+,@>+yn:V@s]3r|Pu|x[nՎw9~m;\*H  )(99vS/i^xEӋyFmϳNľwԄ|6UsgzϾfeٮ9a+LgKƯ>\Aϒ3&gW iR :+T \ ԘEqe9yx!$0 I"DZd-Dj=%Z;wnb΂&G55y}ZxgApPBD<ipM[-jr0GQhPJ81V`Lw&w!@] j_Em r5d!Ĝ] ddY@w(Ùd$GUTB=VHd #d$9߸250q M;a0|v˾AG 9^?6V\(j,gl; p?kdە W \^9|efڞ'X*ya43ovތm>+Hu\h(l899{wf6_\c9fy^qdLu۱BÎWLr=2WXΡ}W\?Y;=_7*m@`XAaAk3MW1XΡ]w6JsgϋNľW$̶>8vbQzRΧb "?hf[r.F3KϘ?hf_e4OCE32rȬ 鋡Zhy|sose94{h5.fIp-ffe^H C3Z0FiiP㱈1@3Ӫ2ƁO3XiYAy<h8>! UfA9 ib4iIgAÓ<ʏ(vBR&9&c4S5)!=K%&Ƕ봨-W["% ǶB^XP&CQ'cۊPZA=1Pԓyȋff^=<Ϳ0) 3A!EڵqldZ=Eڇ?-6xD[E Ml?8چ2R9|3zitL E;R2oy EO ZBWHcBM!>QYq )gH8+I!E_z}NJk 1m -g NLJc=!E˭)m -g NGb=yMϋ7bGb+f)mmg NGb GeH` ''}?Gmb~NVo82.QX|t@`Eg}N[V;^fCu˯zRPsrQ{ضOVz [N/R= ;}V>j ۶/ik^% VYzp]ƮӾU>u_Ʈ)KNqL6X/I7shbS˭C~gk\ׁuEr0KUkM#f& Tj- E,TS|8뾤g"ÙY;R}M7vr|8f@1?v:N®\b`Ox#f `#- `E fڋ`#5JW=&6KAI@"uPTU `T%D6ԤhB6$"iăb‘pL `;M6]/iiyQ\MY/1'`BYPp&#QqN+G2\@z2Oy {K,럾~8̋v`dt04$( -CPx#s>cj7+l $h@q^ttR]nbvEzmqZn28-iᴖ[4n[oV.ܷgs8kbt| [5[6['Es8i'5Jpbƅ4|g }38'9<VF Wv\tbqY}qJq*s1ʨ(g mP>( 4U,#F [ȠU#F M&VzBj|r~dPZɌ|_*f\b;b)2(]>'Ss\ҙc4@Q>w[>wf0}Nf3, Qv"ckɸ3jN4s+!P|^s'^Jծgܧ>}\'O >ZZ?ȧP}%4"C-T] d/9xk.5LI9c7q_/&35y8&N6%YT8(iOHYӐς&cc؎ѢA)m $U}e^0$h_< xyQ\MY/1'p{$1OȲ2P3HBz$c'$3lOV(Ol?}%cjr&\;};*Ў!j/ f*Ц)"TFfZl@O?/a>+юat8K⁊WC}0_J@|7EAƚjï\,ͷi1WRc2oU^ŀ@1`"@qq59}rl1=+h_Cռ@3,Gq 71< [|drq[q7Nf)P- n HZcوϭ#nG},UVex\P1W\I?ڑ b;kxkٵef?e`{:Ye 2ERԃ%Z`n&iETRX@Ȧȵ|8\QہKQ0\IqAqm/Q.:\*nɨ.p $Mj#=] cN HmumGMU3aB^Q/87nU3Od:z%qEmz 3r)J1 p}%aЂ6O6pl56G]ą n9M-KԫVzmIGg8b#e<ۘc}5eB3Ol;z> h'l;2oaǤh;無$.&(pw*vWLbК0'9bMV.:1jjǚMDc,/X^0M y!@yrCwTbjv#coXK8`ˢuyY(t\8lc6?>pNˈ&\8i91W-Lqyk*BEo(GDžs׷ y 3#A ~1!'j2m(aeZ 4_1D{>~1'Ə6p;rțhӈcN9M!ى+6;(91 Ѱ2Oz_u;-MD{Zꮗ1!w:VaSܑб&:p:cnǀK"+ Ѱ;r tt#]9"cy}cM}t̑c;E%AԢWl1ցJy @A 't>1fbV_*$|B/>{bCfxs OlLj7܇/wI6~cvX'Em@PϠ !vM!ff<TqZ Y x?!a;]bouL`r d|"rc~]y@Q1_GOl$PPƃ Od q2WPl##" Dcړ\WO%D quJb'†`{a9,Ny!LNz2{A:e{LFVc0S&+SyeГ,V`\E'9dIq &,I;'E+p@NœCNlr'Xbaj Juk`A=ֶ,% ㆺ A#؈{lD44UD!{W zz7zj ,޵溺M_WK[hL6ڧ{$|Kاv>|GmrqwAOo_eU~ۿO{8GJc \ QiN*F./Ղ~TDvFsc6+j]7lfCRx.9 lrVrs~q4޺xs^~9}9׬.T'~kT+é8Fohޑ%i .U8r*j ei}%W=C88du|p柲ѣѦLlېںLwCK6^6OG.{m:I[keܺ^R]MVQYBC |Cmk4O>2sn)gSSaݎ }z#t{iE]O#NzxSdn%){sҨӝ7U+ee)g,WEYs t@{e=DGQz Xb{H"%H,'l`U8^a^UYoV#%*qm^7kx?rx"H nrMخTpt}).꡴rMեҒ|xIG;ϪvST+Q䵁r~̛)oVR~\c;wbƺgFҔ]Q2AbΚ5fYSsZW-GA5cN;G:ɘ8B)s8]V9]{̻ǹhMbI'v3)kWNTF5u{*$O)sXzO/?kv,ŒYΩ>l wݪ wX#j'us[Ah3~0_Ҙ0|A|NsD]L?_k]фmqjAGe?R 1U RGobŏZ]kQ/;Y֟~.Ze5XxV3HnFDQ`u2äf!NcT0FqǮn~HdY `K&(X`\#A0e/ Q-hTiQE FbŇd*ek5x2eLtA㒎-GId\)d<0H000S&|V)*0%~ZO(q[۷zX  KgY|~x$5[t}ڏ3NJS])k()oC endstream endobj 225 0 obj <> stream x}[&9r}CrxNe*O T}_ղ M):EYtU)ވPdrp?]xm[[qzM6Mz/?~~M߽o]_~lomz ׿/?3d3x}4mooX*U7_}xo^Ǽ^ k۲Ku24;w ,w9zp<ׯ})OW+u=]Gwa#Cr/JMgI9_%o/k }ɒ]7`[<mz#59]y}kҳZוj;=RוHI}b+;p쇗]vǨ: _?6_;mSgc{4X@W_Y2]Z/oJ8?R tkOkVk~=ϳvb@$b@/vB'zF^88Ҕ 0H!%涩*kZHcfiY++fbɇ[ReܱOal>e~34eooN_m^267Ab;}XC,kD0W8~Υܾ=?h.vq[ˉYٱXUkJfH;6O1P:n9m[94o;S4?4k4468lsGHu tnRPVӓ\+aKmKyH}_5,s̺Uۢ] Br4l;]O256ON3>erA̋V٦KaUZ`q6ú>@>W'Zȴs%u8v~h=<|uHܒG,+.M{MmZo>E◄kZg\h5-|>ބI- 0۱nM-F;e hs~u!| k݇/>|\pbea*v6,pz]\)|ʙ\˲vͮhv(Ai!w83AAj*3k13343y`N K>ۀXUv4lο/U)CU+C.qi2Թh_h['NsM}֥it^5k7]&Y\ f̣{VcT{k6Dͦʷ \LuuYj.E_5Suζm$q~UOj)sZE ==|S7~ߝUA3[Oݝuf{r%@PQ}.@O^;L|6{ّ]yFfu5$Wb83m]y:}lڷژmeO2;4sZ /dd0(f hf}MV`ZAWibx GOlL7\m3Կ@ L|6HG2uc-pJeZ c NVA֍ku;@Iq$AX|^?M*_WWvL8*.zJDC*-V=~-/a?A;~+$—54h}Yc{u\2-`D$߫,t>B~stSrc:pG$̍4D_}v_șr: Т9, fQ,/:FomA{GyŐEػ÷yV)L}]Gf5wTxK+f1 ޺} < Gڤ؝G~̷}HX,Y7/ZܡoQڡW1NǒǑP)ݖ_m)y@ٞIՑLwvَIӒmT_DK[R͒%+iZ%$u˵N0Lo6cvЁJ)EbK||<|K >|S <|K >|K >|KK;zXS?Cr0~[P@W~[zujh1]heV#buAYϔnH$m<f-v14?3u?8?le8Y?u 5g[23^rJ^h"k6mʰH> WwNOP81GEزhkqAmcZ\JZ}վSo֖"'sй,zC/cN5B Qe<7Op =~w7Mg*.$>v}xI \ ʑᅢIx,okz꺩b+.q} rsqȼ&$y-Eܼ=jV]+qd3dC2^/费Iy'@^t,,3|I;:*mUM7}!t[ç5Z|%fAE&wK2&șHa0'P|r=WU1YJI%C؆ qP8򗫯0=I+usg8gjgFR%n-(M^!z+4;'pvMe*6L 莛 d6ߓSZNiR{|cviA9-q^[a-iA:-(},ȹ[0wc^dGK ,6H˟1 hX_|79x!:ܼyrp˥Dqjhk.q麼lg;ŏrxЧ)GYM3/Y)ի&z nq<:>'.Hy:&RН8$A3ؼE>,im{O^7t0W0d-w5Vޛ;nJ=p.++W@lP:I]< b)Ku`^wnNe_sg+AOÉF:Ӏxi pUcqy M8a\KhotSwv/Ńb[:V_'5wp6@U}/^r\ʘ=e]nfuGə>?w}=6/xnɄε^*-Y?R}v76'uv{`eWe](2SG:e[#IZ8t(#X8th#T:8XNT)$Aiݏ'#C/1C =m$Gv|,/`(*f UǢ.cMmB/+* ]lc[z(MTK22ԃdLP*Xzi(_M1@ޝڞ@!7n-&Suz-7nuȚؗp[o^ԾZ;.ʅP1{ڷF^s;*9tloK]i:{G xPū1< ޡv"%6kEڡЯFwEY̤œ% ց# ڞ'hm8AVcl z~ iW\ VaGXmnk,I tq.xlW^󈿦KB[!f|a#-gs[6 l"NQRR*-HfS%*#' ؕhlG \`@Q ~{d0tZ1;1bT]$\!L5ЮN*pV̌8##>F-g4Dy͓"~"Gm_syVW\RLiQi>ZcU`l~IsAy:/5nM,9=oWj< 8җ5ЮEwy{òs-1R<+ eֵc:#Ю?y'ₘq>! xwf#v%V\F-F" H#CZ's4$={,aԏ /|D!j-pT~Lidӹn.-7;`U Y}jأ2Y5Xj~ϩGrvRv(BQ\ʙC뚕G9T7A Aij C թO|AKנAXY:RJuuPР:X YJWq$ ցj$H*S< PY0 Р:Ï  Tgx2L vb #QoMma3L,ai 6E A-?L/S $҂"q,Z7R9>Rb\/G?D|6ig:sBK׮ѭDΣnԀ׵3SG@x憯$FZiziv_FR~gpnSY?VTm~).!u?ڧBtIW5 9jf.&|}lʑ-XJKtVvSp\)/^D1^0#ݜW>pOg9DCwjNr?= K$;gw gw8Re O .xj;_υqX\.мOGB<5 3811xvi{{RcCОpPA?d' #!,\LW i%OmsmERgRL}c;Ҳ"?}7%N*F39/5خŖ?$;g[oKcO~X=>AKv"[Pd|#G): GA/v@UL`Rq|hC_&pPM~9+v"Ϡ2@jx>:wqeP ;jֳꖖ`''wBrp᜗Xg OFq6눡XnOLiO= 0Ӡ!I:=,K:T0PCD  14$JYgH,' ")#:bh: #c X}0a!PX5p40tNIBNj-&˅(MMѶ)D9iDIgk¤25Qژ(1LM*@OtU h" @C~L&xmXy8XogcD06~fOAyni]OJtw.1ӭI ~ )k6Yg¿L8eX82zwεÐpsg>ur93\`LX"F}K\+L,q) 2ajsNu 9;sY>)si F|xSAKaD-#-0P b q͡(\Ko]wBT`\Ы~Q`.gƝ ?ƾ$Xgq8SLC@`@A7xF;|Eo,A "f) tC),3zaI~k¶mK4GEv5~KzIΌ<fxg ,Au)I;kq%L.n9; 8#^x+e .|wK(N,O`@A/xL+3WXgcVPy GcB>͈bp#?quĶ> ?^N{&Ԓ@35Qva.fF+#čFxdov%YqC.Cj.SpbL̎9 O3ўjgA-׸<1BgC@A"Cst-j""NZ Z-,d0 fl9X!:Թd\/ClMR .+d1!M Rۙi[V1}",5B|Ur[Q@1cE'zLcDM c,B$$FOL9 MG, 3^`4^ha\C o`*[2?~+K#&gaFFu fD!ӛŤ:_]=emքC0n{2ퟶih9BjC>!G8Ad8?03(] xpo;YR[AtIm26^FZ^,nj-Ez2!8ԏ[.|6p/]YBRwĴw= 2A<R^lRxՒَXgqKbq Й~ =u~D%YEW(  xQ \KXGsDk1*Aݸzq1թd70C%YR}U|eChN?tKZskXКgqct^ո 6я[g$n| &-▟9`YB[mNeMj8+  :-5#%YR9RD i(5!`O~:u,s{m[:I)Ϲ\ |gLFa#hŒRؕЊg1K@Ӛ4K $hK7 \k6ӍXgIŗ.@ޕ10淣X.]Q:^юkEyEpQE>է>7p2 N/g4J6=rk$8k1޶b @yGZs~$@@' U;)Ȼe`58 :l>xY=oc.O˕ S465k Zl++ C`EMg8gjgFRk> զn{S{\3t;"@in?,y2t{\^jxlX%1PrrHôK nn kIiA9g,BY r sz8d6-%Y-'E5$mbiFJRb8 cH <`Y`8X.⾻ Yw^Fh8}%|`Y,{gO^5Km8p&G7OT\$ u Qt'INt]cLtTy6qRxߞ8]jBTLD!S3 E)f9峈,{tn4v䧃ji%{V9uqki&/{o+SZҳMzx=Š%J%u7K 1{ &X]`نrnZH+ Wą<!`챙ym %/3 ր[u6a8a}0º{(r)īoM/Ȯ= Z˰L{7RƔ|U z.7:LFB!e~Su}l}=d6/:f kϟu Ip ^*I-LN俤J'4QO2IEKt_'$%M,1ekJ#P̫2?'f_>!4俞SȞ&t_'&fxf>lha Ui$&]%c̔2 K%)lPZPz0,=2K&9']"a;>] #s.25dݾe6kmVVkO^yiu4qH{7s{u2TSp%$-Lrouky_[嗻$Ǧsd?osz_؟>{)qq~ھS\@s}r~_'~ӕꈍƃͰsyvyɫ:Y!.w-2,Ty >)}j]KwxP͝S%s#`Z谻Zg D}2$\xּ&:'j;:ruੂ Cq<#ET)*OU2Wj)hG>ݡ<>O%#%ω {xj;>S-uri<*P%-]J|CJlP˰1I"Zg#Vdл.±:lRH}Oq5Y֎**k"֟J @17 X-AhDVdX;NadXmOtQ!pf"~iAI<GjamH|e`$"hf28.L= )Ijg끼2`ʘz0L=j5KŽ{8*|wgV]"ޅg$(ɯP*j\\m UF^mأaVr8:O}޶'mE#Dp/߭ 5]8b}@^m /Đn*8Cؾxyi+`ݠZ鏙\'>馯|.xĴ@ۖ ?S$WrF6f=ЀSrN| \9 >sCܳs ?8 [HlY'jr~> sY0g?'(sϴ' S"g@ k\.؉?_m$9jĶ{~У D(虁H3 xhDBg\l gR{"G}A^@E?GfSo PO~ <ܱt"ޓDiuE`'Azy82lOX8E;t]Tmu \~ݭ?e;@+zDQ'0P';IYĎ̢[ǚ~E毕k6"Kz>~A~s3{m04o/D ? 7RE*;g15-0dƟIHh_!Q3\ aďE@ ,3[1[d )ǔ{xg DrY3~?Ngփ0;~==c(- ӽ~ y='5HM72NؐL!x@U}*Z0Xk^U9b%M]-F7hb UL{T[! SQ7ؒcf43rcsK^6ʣK;UT }p;5BY*,\k!W~cs9Șn{݌ύ^FGHP,FzTA"S>$4&~Ndt[fyD~J$~N!0zMKv@’+EjIKv\)p9UF\2UW4%;7I 8L 4B3*N%R)iʨFc$ CS %X쀹rD&SF[sHbd SgB"TmHh4& B8l!C,D,\œ6(]M(mMc&S冩IX\Ҝ3zc BF`|5knS.g.'jx0t ZQ<`Y"6S ܌Oً^#C;U;x.ܩZEj*܈!`^GLKgOT `ȗv-gR[r%9;L`k^>bY2={;cGkiH /^v($d!2:tNšXjGxё^N#U^:'ַt?121yW(;6']nxp׃[q_m^:mE䜮ԔJ?k-nt<ͱrL"ًg ϔfp(sj;>uØ+!ÅY!"Ǖ2:L"J6< rvTnz˩>%ճm]W;kq%\ݸ rvi%խ Ɲz,Cjܩ]}!`@A/C.>4xCx!#H2 h*C|$ /tLMY+g$BoOYƎ[CdXv%mg"#OsV a >Nt^cG%:BhS{ǩ ~ )E`8.$ $JM-FBoc¢L ֯D!yF}xv\<,H$C WFai2Ub<,-HHZ Gc1nD$d<:N!)|2HOL#M:fxq#R;k]N#1 L!b:;28zX&\8wmQ›2ʖ %C)cl mZsVG7CX(4bn 'ANQ_f-a0vkVA-M- c_c;H>-ۇ'ٻDAۃjdv+9G{sz.Цsg'ym$E`"R2˰i396F9#diRs63r4aG0e8_a˅%~}qF 9{tS}"g=㌜e2[Oq4&ReU~O9#mJDH>W8# 20&ȋ5-3RفODH |3W܎X8#LxUWQg6x"!62nУ6[Jku.J*iEHvZv !l}ň{BY`Qݸ8ǴH;Id2,\7 `J\,&M2.]dNP ~ݲ z0B?@\{`m[ L< >MOzjWc ;I/ّOGDDVrkG, gqgF۵"}x.^93\ {q^pG, qgjܩ]>`<T $g>dCnlG, [f(@W F0a=Ԁaٳq7FaY@ u(yw#_&6.f} alKs=iW L(x?>5 ` j[cG8즹 -=@ E]%pH>Ho}wX„57u;\-M1>EιGp-wlxs\%5d,Hl CKV*,6[ҒJߖfKXZ-lbK*-єMÖ`M&[5l 'bK&-QhֺS b4% 6El ˧ 6|"jn[)#`-͖=3LDfoð6q$fe`$b͸0`2ʦ &ԃ)cl0 X ĥ[g`9[)#0qQ6_bWoUYgE-QێliM}Kƻ]dK1bɖ_q4]u\;W2xƖߴ} 9Ό^ TUA0IrĹyWC5" /e7kaG~~3k:H^!0*AnO]X?3cG`-/Q,R6]\&[.ܩ_qjOq@, D92`}exEe twv5~2NAΌ;' 1[%QܷbVLC`@A7b1{(5Ĝ@Z` bV[C_C)&MM,5Ĭe=EY6^Krvkl p#({ 1qv-~ߍ g}![q ѸsŽS:?P $g1z(5Č!f=14`s!h1c.@̦m b~9Kl֒`G5Qʻ fFjȟ#oG P[v%Yi#C^]juSp[1;Hs[%YizK(cˮfM6J(?@QFS }W-hj1ӢeLtd2&Mʘ4(c'D&e쩢B3M4E(DM}B4(c)\{'eS*iRQƎG0C̤d8uj;$d28zXF6P›2ʖ %C)cl _㒡aQPFB(I 1m9rkުBc۬2S`P'tPoQEk۩&{?Nwߕ#k7M~ocX2W :jɯLuh{H>;κG=:zup-^#cܬطVrZiBу1 To @蕨mrSߌA2 GpAS -W!(Tp6-KPu3>G=4L=1Pq"N5ζi }9ž E4Toߧ~)WU)}8tM,us'V~B;'*v= rv*ڵ$nҋ b-n\">$% (  [K4e_ywk氅Ok}{5sܫ{螎;#9sw&,-h*Ռy9 Uha-) !ᬏX 塢Ч[9e 7)nr+_1Pٶ@Kœ17Y.ķq 0a*)Y lCזiYI#OndeOG/,R#-`y,RUu#~g<R %C_zbվ>9bقB/N U=AmIĞepHߙa.8#?/.KvĶ.==%5،OkRy{|E>4`ׂb}ׂw /= QwZ Ǽ/WQ}壨|OH)G4<(WLY>^k _Xw~+>==1,CoOw{pcJe(I z(N1F6]C3ߙR;I6G+p]WBi]L͝5q~;S톴cOpx3q&=ta!綌zPeN猓*D@RʁAJtwZ g6 L`s{ -?q˜U0W4qg 7 <υ6rg|x>?d@c/eAW =7ֱ' 7zM^ r8jz}Ztȶ=_[w-ѿ_$ ח;\'@'Y51b@c/NC2+( =C?&ubW pb ?>CssĴ|}4}n7Kl٥myl=۸5 [pvkHk6mߣ@p.>\q5yeJi9ߨqǝ%Tx;ǃGAf8$}`u>I'ßo$^Aki-]K+g4ח;Í`QID4puȸk[|p˴uffuu3mD??k:b ^gĞ% q6t}7\'aWe0d` ^k؋u%ᐂ^-Nf?@hN6Wsg?L4uJ7!1{`h6lRfy)yyY6nw@f`j}m+d {!$[ -ڈBZj٢-*=lQTd&iAX{!MlQ4dOL(٢J)A&a@) d 蓢'&[&H9\A'[t|RhrBPiҭ _~ /6wHH/-/wHY\$4t>I&bMcP$5zccV^ǂ/^RL Aŧ=srji۴}JgY<yzҭvG3y6SW6}todd ҟڕ-鞦j0ܞYO|CiV ~'-ܨ"M]dz bey+"gq8Svz_~iZǍWfNMuHh [*Bzoe2R6[3GC9u} T&T7_GL[2! Mܿĵf̪ܤJ'92\0Ju[{EUő^^;[=*mg nM%T p~a-p)i}lHXo;[fL=鯫R+ ?wmׂ֝"ϓޘ]mGjѹ+q5=^ԫ{3X#Cղ"gXէ pX$֭u߀Y"+ i w:hJ܁>_^ >y=wrT`exЌ^8{dcvHuK_$7& [!eXŁZEݍe ss(O2|g;]X?Bq*m"H5*(DxE('}:]MtYlFIs챆+~654@p.I_Ys|~I@!Y{LRZK#}{fzH=A,/HzSC‡zRfPQV G]CL2f tQ37pqw /]%ee)2.:P82;R |z8cN?i\-_bcpT̚16VCn>8-2m'Bgt?mp6841˯Ҵt~~Wy0_3g$"Sծ ` 7iЙ+(IJradSTn ?yB+:b` ƭ0d.LLhǭ#d#NTq Gg,pgd~ta* Yv æ>6:b` ƭSޏIqk0Vv2|֧>G,)̂~EI`F \9LpݼpLnZ=ˆ@Ӗ`9T(q!a0tϠT?tDc臮H9m f«wX6X qSn["ӟc*vY~wnfgwu+Bً򟪕e.lyd+F) ٯ7wUv3>}+0!'5c!c9 oCPZZ*6gnw#mvp)"ӹ #awVR 26rD<=h_ЋQ(/o}W LO`6}1k}Cx K@@iN'A };2P 2\򁙞& )M)|p3Egz & @28c4'Y,>1J# Lst|W5PMǣ\!)>}+fv $^ﮕ&\pfw ʊ_*;We2К.S ͚ʰ5T.5\{+2޸kbs*:9*ؚ@km?8.|{ Ƞ{/`72d0Ƞ{+5YAw“ endstream endobj 226 0 obj <> stream x}[-h7ҥn}>g0nA?dL: OI")J%RZnqHWe#K?׿ӧ_?/~/_矿ǯ|O~c^Ź/<}߿fys_>-~}7ެ˻}omfYyw;e?ߖW{o/?orJleVn?l-ߙZG߶~:>s 6}3cy:mc/̕ z|YZwkbM9Ooe{|+b1[0+v7 4pG|I[~oٿ὇{e^k.lxuSy{qk2ýGorO>2|Eb`Wy#^ƻe>6[Y϶(s2 " 1~Jt]c~G0]>#Ͳ|iܮ Ї?<V6$Gj^JM8r: Cʇqͪս~;kKȕވ o#l1Bl >~7\*^ z f+Uvq-y'wǬ׳ݭ)GiZDx3iouYe[X_yTx'*@m^|uOW_!} l \a|od f/&N|aQ]h7^ gאB*'% Y:8aP/AZSCAoɩeteo}όⵃ㔆"wA9\1~?>]?aސ0;9Asrq#v y0I pY]bم@oȩS}_HsKtdy@I 3Q~.eS":KSP=/!g!30@ Dv,]J`oiD?\3jaV? -0<0_qfÔ9\0EA~'p󆜊9ΐH<9 ;bELaN,xY5؜R@A FHWR -@g5$)艣(P2[)4ǺyBP8 x t7tr~ù 2կF*zh1ߤ 1 G_6/ҍ"ZYY wxU -I>S;b*+yB.O-txo,q.3~B wSaM,}X[>nnEUHDKmBC 'j)>EHN "kzID ݓ| EA'$bO{ ziI"iǣ|,xGM S)B'DB2ۚ ^USS@ iz0L4= Ď[Fm} ٓbE.^pY>wGOw\6Zh]‚",YLѶfٽF޶׸a˨{yҞDՖgi} nsWys~m]v,ruor{{377F?; [ڤvx}_.%_t9:u?=]q9mĂ$ o; $Hۮ>:n:a[mU8'Ky#~x+Ủ!Nlbl9#AF6ؾٕA$ 1_[3 |_)~G>zJ kl1`'$] `O`o Veط>`P. P%2D)o%ݟa AuPvXE #v8奠$Z> A e}˄G6XOA`?)%$Xj WJx?tȈ7=No#Dd񧼙t7[*D'ydȈ7:\:Ht:ʼn{u_# f!2$_2( @)/&)Ԁ7 "|f7 E,79406' Th41m;lHp/kδ,^9v?:{c3V]Ӫ o"c_zD-dk[iϸnvHؽשyo[ײnZs焟z|)9aȪJ0Mm5MDxnE% 1u*½F--g n66MCv02~W Oz=u ,撼8cvs"j-Zl k_JE( " Tb{/dK |zlM@meJW X@d͇ /#z &^.0q<2Y7o̺Dmmc^9eC5-R!ޟ\M)|Tԑ5UD*te ;H\A: bq$W d\ԑQۀ0~]+ܪg#q ZE ;)h)U}.I-~VIS%P"!5-t?{,ԑu9ﷱϦ˭9/w&X_L_RҜTג\z4F, [性`]Ǣu_;6>vu(`⩔n'p(l.V\ྦྷ'{՟͌z'՜c=[!R]RhZ ohc[eEmJs`<+ԛ84IIH,Ht?{N9R)tzuo&*#ԑJ"%0,搧) 9eITP)Wr(D]Iɠڕ^qn%Aݭv/yƬk4T(EMN# 84Xa~/yTD&JLBv{mLe([7a6&M%j>p*SEpYDy2Q 9u,SCOVV|mULMCGT|B̿R?ZtsN*߅;B[ c?&]BL?Gk|}xV?Ў{ϰ#,Sώ)?~rt7uG?Ļ7>!ޝ DB}H_*!Bu{A, ! Be.DSȵKAx( } ^ B@\9Z"q,pQ"|F 2.ƅ."?`V@2)Ksyߝ}0oxzwzz*DIOk6D%Xs"~<Nlh}Q.K_Ԁ'}<L_w5?7|BX{j[F/Cy6B~~!~b >I sˍ93Oˑ tZL'K9|@@`ۮKnL7*p' |+"P _ԯr:XqTÜs {Au+V~!n|@>ˍ-,#+ix]彀 9w*Izƽum^n3`d)`f'~N_l:OONԑGx6ь}W! {_1mWwB%,SS on``fdpE+0k{7Tة8`g53#M;^gxs :t V`pqbw p+o4X}> `g.[_El t}C bH{'<܎~HSA^UjySW98en"ě\xX'P:Wts&flqgpn̶̷te te'ҍ/nLDe%ȵ^:D-7 ߲}S*FLp:rA^FH' P©Pu׺5?l͋4 /Ju@kuJYoCE@2}y{uMF*`$j`z 4=) MOcڧU8wf/A*9뉋%81 Z3{8U>~)+YQUn_*۔=If<6X_{do׷e?b*mI%-lg>9 u{5|?|dvv%7Cj].58Db לҦAp].' d``(mjI,7PMIa!yt m}R_E" NY^CU &u]Y(U}5Ax0xTM;VI3eH@{o<ҽ`w:l4.sCۓE6HXa#(TG{oDFL\͙q24O'v%+ԕHDxqpND$80ԕh 7xywjHM @.%ʘ'FNy'pz YHHD}-f-rw:>o{/Qe LJRNǝD@2V6ns[F٘( |RBN8D>f̀8;uؙ(X8c!N-@<c}+'8; {.4)/omH @v#[DՖo&(_tƱԡ'%,&.#[| 1["E=\MlnNз42l-qw:#K"麈+n{{7t܉NDs#[<ij&Y7ŀ-9xbZ,c,89qCb èА0* #?ԟ#8>+9%}) bP&=܎:{ʜHmqsq١(Cx69I>,r11H,iߡ x9qzcL#,*ZX9tnQӒK_z4T) cGS. ]\c$M*HQ iFҤUJMv*4\s%X($5գt#hƎST۱#1OVaq:{gGz֊@uL@|e2r磪^I@@zR\z dT= j{ւe\װk|YFQIuI5wm v?D9[6f,0UuXFg%f2u]ݗsmXϣ+κs̆:q9FY?-~fyhDf.˔N.K͍h]J郄HC<`N)ij}w8+jH)(t?}5)-PI%#M3g ˈ8;}5w.ኔ^]r*3#G,7(9ܩ4 w.H)/&)ߒӁ:6f,$VxRJQy5ILpaϏJOPNV xܟHkMC[9N$zFB.73c1ir+?MkYS] =#gpmJOyJ)s.q*W*Bzl7ÈV|RJAԔ t?cgQ==0d(b ݘj( F|SJ6l5{N7SA\y?P(ښ#Rj<7JFX5}.o%W<MK.I״@?kQY'UJ)'Mj4)'L&-QdrTӔ+DX^U O,Ф';N{N_~דGiH3Scc_ZHV#1 @rvd` &k ^Pd0H50T=W MFPKӡG5UK@sܔ;ǚ ZQm4\63uLvl. wռ.m21 Y|k 0i*Dn2Md\ qos4 a :H-eπw Vw4~j3V#$q=M~a+pv;G7怫 \d\ \suT-a :WG-ezu~;G p~?GpőG*dFε p~?f8怫εq[gթ4,~*n3LAwT%]g Tq?Ufbє|\IiR>b<i>bQK,drrVӔDX W y'U|B418EDQ^?Q!`f iX+qa$2@I'Mx]&*AIqꁐQ@4zI\pd p! 4Ky. 9d.(;Sb;<ú'-J()t-`x&ʼ(m!1p+ft6~'0qPP.# hBϷWnNDnsQn"6 t+5^nlfn?NyzÏrS>~s+D";?yv"7 f#^ XԈO0e!.{VWB/wE8ރ&" У|3-(u唽_nYg@ Yo1SRd{?"+Q[;~iܢ )3d2rfU0A{$s@ =xbt;' זAQ ;P >(ZrE{T-d- whR\d;= Y&;}B4iAGU. WMS.$biY(4XV Фs|OzBǣ4C%V$Ҙp4f }Y4t!C$Gׅ U! W'D]Ę GՄjj,.ǩw81>aq]5G44kgS7'! u C]Zq7 T@2> U{` ޗϋys?9>׎ޣ$Np=k6[0tرeHqGWE:-<5#aQ+|Op\7an*>^{MݵKHi0/]?s?{{~?΂5vFao:[pN.!. C#wz}m'p&Qp?<@UqA}XTUra[e[87`ETLIے{E"CG@> K2>S TDW!!Q\~1FLX9sI22( A,x%@ԡ%IF;f66bE!UoMi F.I^dI.q#rCX_76bZ~)q-}oTt:ഺofؓ`͘8)t9p ?roAȝX7S~;Ze{nb4T֫1щ(`먀?7Ps굙٨3LA~]XR1FÞllu9ksNo-{H1p\}~a> LP9ܧnd{S{(`=9a;҉=[FlqU?^o&|lX[fiFqڟ´ܾ_KZK{ Jz #nBeov OM,%ǴFc6X ^4}kL. m!6IiutKZ6ɭawڷ5LYLPApR B&?y}zKt3o6g=Yǩ+9yvH*N-A5s)Գo}ۄXnULM75 bY)RTQ )& JYztv^y6v3l5*nÞ4E׷W>g^U[|lh3T~&\m=qP4Ti5  8Nߴ׆:|5ִBSgX5◵-~ ~kiq:LTMV3)n)}馏#[Ǩ#eU+^haM}˪WjZr۲ZG$UJE`GSnZNE iR+IRImSzJӔ{DXVj>:,'MzE`)*^p%U>*e+u f84]av?]#f$*{e+TEY+(†dF9U1+0e+Nx2d bul6'[CҀQ})Nd-^mAka.&>ɨφS*YS͡nZC&ϔSHF}q8}kφӷl$>N`M=W8~,ɇF2OF2꓍I5k\(BnYy{ܗXžo?r뱻ձBچ0l+áV6n_~omt[}v,׿7o?;Exj_9oaW߂[Zw>Ρb^aoW 1=ULWwoWj _݋Y~ }2p/vDv3r_S[n^oӼ9k/b6d'uy]x?)e9;@d}#p h?w Ku0c@855!t}mT0E/AM񗸫u뺾к<]}rתUF[X d$[ށԍ'f/ Q}MG}7_zCe_!0]Y~ѷBrl^Q&(~{KU~ m-K"?^xIJ-_ {˰?׽277F-rj<3x %J77!) mwIu޴< X)0( >JT6ATc:ѝ_1excetC#bӒV:baإߒ{?÷x5-ݘݟwWU,M/ ےԣfÇ4f^uglI|İIzm,KH~y=Xk'CI\4Sb% үl%V~($Pة[Ol`Xr嵵#|Jep/ܥX,P)O\RoҠT3֭\ !B>1)v bgj/}Ķ vڊ.WAwa)#wl_=5XO{'}~MCQKz#2hA@ JĊ4Rn!,3(1fGi`7,!{ؚ*Eՠ5p8=Obt7;}ԓ\{-3sR9BbQY̬HI(%n"Ќdb뚆"GzߗC>ժTΞ&M55rƍPGյ^zN][0w:S 4>2fU} z \u ^eڵ81c>yꜨt~QQq@h"qM^%wWhA-FHc7M{-\czyt?} ̣ÝxN? XЌ^{ }?O;Ĩ+ " sEaWd-z3pxNߎ0+YUd;H7ׄ!#O2ʏ.aʶgu=0iYsC9ô/]haQK==qMj)CVYf,{0?''mO` m3پx@LX$$yy]G2-㛌ꆳ5F_9ƆitXJk(eC6Q[ ..%NbvUdp~_d+$ )B'hBlgHi+_2DPg" 4*]SK)1 c(rYDgy%-fP̯جi^W!kc7ЦuM+@_6ۍ,6ҲV}k*pZ%kZ 4 `:ז:ߢl%4{.4Fz #5F,!.m: Սnu.p'y_թ0:yTf,sf]+AEoAfC6^ .RkBp+KV?Y]I\Ԧ,jsv)$~_/>EuE>/tq _J8 x%Cql{f4P}o2o%q|NLiϛ8Qj TBHR)3<WcX.g.u1)CMœ(eEiηasL2y1}w$M[0ZY|Ȍ?U৥ ހLrQ];]#Pg>[{x,'г{mEl!/٪ B,B+PTQ`ڇ |SϜzrx['/Fѭ=&]k\~[*v(K\u*oWr=LaX Rfws  UhXS#LFYgp3SPo^OYNG~{c}W)[WRQ0=9uJ]3Kqu„N_.jKo]mS;lBu=VՖxT fޏYjoWVbcbH=*^ykH>JԂm;]w]5Gi5:hZh #x}qHNrb?K5e*lEnd0@ealOlg -/qˑJJBݘO;|}G}_ID>gзjof>7"xa%DQD1 aD1G*ˠ\5 T1-=J ɰA7}oƚOV!yJЩ@lkʾbr},0yT#x3v*vH\<^?.:siL2kƮ";$6JAU1N, ($I'.~{ %1%d-mc5>as&q Í u.YdL&0Y̚X;Rzg2q6+PMK2qsRq:?Bs endstream endobj 227 0 obj <> stream x}K%Ǎ^] (/@Puj04  cw{vML>E2QdH~d׿O___~?o?>7ߎ7po|5lo1߯oCX>0.޷<̟ccv{|O(7BX_w~7nnQ) 1| ObTl׺抽%rk8aߖcymk/~heyMo۾=_oo~~ǯ?-qi-[SҰ?~afOc|_. (~xv9m|֘׸8m9D$r*Ё=S-Fb/g08oZ > BW4y ̗_*qq,?aXa8~^x׫b@ka?mJ(tvNm@;s_ yZ 㵤s|~G0ZMΜ5 c^k8K*. l_2u'T, PIHݸΧk[sա2x'`U"Zw}f>hM}< GN9$+?hy^= N?!$+?u};sr|eGGRKVpX-}/3c~[?_y!d+' ²ˠz*c#H9=Y^GOQM)ɹo:nC{%jZ93'|~>btXv?—aòTv 8 W涽OU:n{DxH KxL6bGt-}cڊY}r'VOi0 xh6mן1m7jc6-uV^.8U J-W>`X0.9D.g&)=ٗ@ZBgqG`5du͌NX9b/{bTB4<}չY@0˚3$.zG}5։@3;Tt+: ^~29c~|Qހթ8 مgq'|CBB\S-87r|CNo>!%I/ɬ_[UFǥL/O`Oެ)-8z'ʠC2Q|Z2DDBOzLU Ya>ZZ"]d/Zdڈ@!8WOF% :s% Bֻ Xl aBemߕJmk@f<ŀ>Y-87r\'ݳlmPZ+H'k0{Uɑ֊#ϕ̮\,UCk8Jze% naQpe/ enD!̖l=5mh1uEf( ?KjJW+`L?\B=$! EA(ڜ'R{[\O=Q_ ٱ~xBszIaY;epquYaP΄̞]\|uC@krkc[pnc6|v o}uRݼnU_Vև|}3 H5 cB:=TIIvFkşل0zìP aVg022tMu+pbx N0adU"`<>y( kz0N<ԆY7̚2LԆYKE{=IK'c\BX#P"H0z  }O$ gpG?vWL@G&;=`ءuW됟k5*ȫ /_Hc]kr4 pxWZ? {0˸4/ԩZ"õԊ ֩SGiq є|Y?|b)8Vs.ciwچX`LJmwf:~}:~s\GߔC\b+ k}/Ә|L{$/8-mǭ4eBnP΄jIi^ПxljC|ƺȯT:fHY 4ZZng, RT riˁLB=P~.- 镂 մXғ4TE; e eA/GP7_"m_%oMS]||Y/d9z2uJRuң7Lz4mٮ>ܯhT -UK2M C:0:?[Bq9mLISςp < B5=;~,8\ mID˷OB]7=ܤH c3vxQ_bԏ+U@2݌.ٹ;{S-JTX R/wNPw j}ҽֵJu0|<XQ+m1ؔԋrΎ\ aWQRaJ b^\[OTXTLK}`[e_xڧ/ܥ.++LUTV-LdQ @0@Q@- ?h NӀ+ t+pgka eZI0& ;ϡ2(&_R6H''|i@k~{CY"pzc.J( dez>ǟuzi\b(,Yo6p BLT>I]!X%.U6Z{5N(m'ڵ )]#~{Qxu g۲%\9Mk}]u[4XQV\YM׮f] 6YZVgtjr?CDz[Y8>|n\u}tNذq}?%v?;{84_k?~4~dK~VjD`*ږ Y}ub0&mEm]M{ڭ@q|c4ˆ~  ȁF3F0؂.ToGKͣ{B@@gw@qքCX'gőFgόx0-?|ڸ!N\PCz#0[}<f+AuF<]2S0KOgQ׼jlP>]QZ~W_(TZA Kt H_r\sN%Ī!UbJkctbx ##u),2ŠB]<bViVxs-uN"̽FP/)QRlDbDzhHdl(5pJpɏ2N=(<([{J+oQy[&]QX_}s/__ĀE "$2/bAX1ln4r1.b$6 @eX'.z">v.bhXV*bb'W#'"K)_81n_P &$,wȝOojE _:#yd)SPئ*6FMfQ DLDpgDxTt2Y*"ʚ1{9?qʼn]c~-ք.}o1:/ ۱+(0x+uqauBPƂVµ+0C9%X\ jcKr$^E`3 6vB54O< @[[hYu*?Uʈ&;: zζ|qybf{<7.9]Iȩ+aTsx92$,d~}U{7J4s}o_{l^2yMw˧zŽz!Z|xmxr6_2Z1D3</|q,%Q]2W"榛.;Dž;wz$KiϘ 6g^ i=ݥ"`^/Ozч^YuAѵX{k[sp)P4ƀKȆK }.E6&\jXp6*֡+d¥6'ڱFN\`pX N2'.9>Љ0d¥ɆKJ FV&\j+V(3 Z$@/5!1PӖ& IfP4LCfq##,ҽaݯR&0R k~|6Fb;k w:=X# 4;A0?IP,vE+o(`p+ނ_^\NT]U_ 9+ƹ\\kՔ\u7wB(J\h_zn5W׾ ~cHH~Χ ^Gh$(+ ft 5[5zjM /㯪a akNh_=V㯶l4~QOUoDg[_˷׭_AkUߕ%ͽ_eB0XSrnx5nꗺ TrWK{I kկ1PʡNM[hzk-;>j40<\@?i ȭ-^n.65Vh^[}wT Ҡ60OyD<Eۜvq=Ԙ_U&sGՊ @g{\ۘQcGs,yʂ#`zrUڄF `Dgp}2P_xcLJ)^o0;9^ŜujDf26߇LCgs0<=.ٲ ],v\be L{]u>|kKt/&Xdw8><`bYvҷWBk1alI񈏣]y#º>bL˰ {Ͽ+SǑ//W6;8mĚ^3PGQo7R|}qH{mE^i\Iumⅶ)<^ަdFMr+*?06+gݺ+ >Xya]S +sQZmKX%U1Y4V.w<g5\و `%rFh[mX&׻vM6Xs}dьߋ5)T"*%rNi;bZ@{ڲmhl rW:@w?`|sKmpyݎOrKp)\h*<ވ{U{ F)Kϧ {x"˚wmPs%(zADVw=GT܊ @h~`ţz۰c/-^%,%vb[u=a+4Ay>w'~ɚwm`s%0znE]E{}ȰiƗ#ۆƟ?*PB]v^BDկĉf0faLsc0Au=_=ԞNTwԬmxGY ]P Fa¡U @< U 6HOh9~cA@Uܦ+>E]g}xݿ֧?p?W cQ G XP_T`F@zۤOY €U7鶿rV`<q3:nn.p[P:%r/*'Q6a׻g/k}L%04+k+e $2AXln?r1$-I[48%Zga)~x@SR:< r N-bNR0!a) T)=^!)SPئ*6FMfQ DL or"5v|g8~״=Au6[uY'Ner1B ;A-nk_UK‡!21kضVjǡW  Fk՟qZs=#Upu/[})Y>0,^g!gn4fxFh G{:Ǘw!Y{p:5O)Ms2!l|G0-[!% F>GXoDh۾훍^c'vhg4IȀƥwI# ($4%^Dbӫm}s?j)M'ĀımQ m˖>COjdfЎ|6~q4?꣡OC2="࡛ Tdఽ@h>0 ۾݅5;g9KĚLޅąjz"Ђ057%B+ W^i_{Qj}B XBڷ;(XJT*ܾkMs?'&pUb=Va.W}8[:yXߚs;Kgo5S)4YEI*{Q֡>:W½3[_PD*`nXt,΋c%Cjқbw)j<E|yUה,\,(h]dcu@du>!Z\,`åֆ6 jYdu6'.@dNZ`h(6'D똓ٜЉduFJLVꞐ轹 ڛk0`Ӧ6 Mf`4F5M>²G"$ݴ:/)Ll.|徶غvǪN<Jzk+woiO:هe?x?_Z 1NԖ𼷹7خ>9 ѓTnM*i8t:Hpi.*[#uhc 12F Eԣ u?pD]O@T!Ӟ9'b ԍD515: Nj -h-g,LCt. fpfj·N4 Yg{qGHڲ^V>+Q1AKb\ϸ.B֒,l; WløY9[s =gDfsٚlmbl-6ImM2mpJfmTLY g99WuJscT;> |д\}};W?z$K>D9| ղV$bjwhzW,'#Y>ӑMuԹx<(m< @ `K.be=!ݮF>M x=i|$Ig!80='P ph^ m_xmF-3 3} & p 0hZ^"-LQԧg:@ '%;:Oّp+<9-t\Yzڜ\,tbuLaH;tΓ>왙._%_yR}'WW<dzΓCh+z 'J)3xd!+vy?ą!1q5;OR:{::P}'G})Y!{ޑC*Y~rۖs?8^Vf8#x@.9vƽ݄nKiHP.qG6PN[('UG6 AxIi(؎QcP'=[d)Ee8nKRgovP4R"";EjC)RdcH-6"e.V`åP6N2Õ=LڜJ9)+LJQ)RdHmN :q68)RdHJLHX FH7zLp~:ƴEIah`Y4:& GXvJR]ޔ)SwF6:hm q_ױ\a҇-y~H;)ƏsIZ$&Pl 1l sXV5Ou! nB\Ier-µ}5~G0Z@idH1k]hl!;ݸAdyl[_VQ;Gg/_b"}aZ?%[wZo XoTbذ>r#S =I2v@ Nкg5wo6C+%cNH'_O\.BN'm~Wm^cu"82B_ζ3wZwK]v?Ӣpv6,#+Ea.;=@&t"`ъaS?۹d INs7du1 ox4/5;O߾M~K]L}(w51mX/"p'~-;Of]!wn8Țw G s7_4 AbA#h5}1o?3#qdllz^= n7ÐCFPfي "rJl(ٟPj`sA!ΆX m8MkZ ;e3N暜Ё98kBT26'`L6t,3q,EFfP"X$JYJ;Χz%x\# LߢUmA46 l"G$6'IX[y|mqe) 4IZE&1SyҶqRJq_`PV]ɾ+ücy.`'Nf_Zq+T8+G\]Hߗ걯;+e|{X7ZL#k#)=qJ4UaIO%#5AU3:_k-`JDmLE%p^ =a|݊y- v@ aKm?"|j9 sQx[nO|ÄwH'Wx_pK1Q35gcY&\|= ◅h7vYA/+>C&dI_6;I=;Qc6:!U@s[!ު "|f9sA` oKE6,3=*π|t+"k!ۮ̤Omܮ v?.L7@~TydjrMk\`AZW)PIuȎ5=jkQ4Wx /D )?+eʇu?密i/kߋA&<`0^B Z *(IƿmvυC}քP,R]&#n1 &/ʫ%ñg uwwl%Y'_!A%G*q_2yOLwO*WnUn-6[=O ܂nn|j^@rk.Ak2 89#FdzFKk1e]d*9`ҭ6vPQ_B,|Kj}r&2F 6#5;C qo ik7KT Ӻ7#Gf7GKSnu7vjtL=Jc<`j%ϕ?FdO{FkP\+ S02n;a_B|L/#Gd^Z:c=店B F} >6#GdV3Yx3L63de!,8%\ojNrSզ-BK 5ENPi Tkw:STA)S*jLGHQ`ǯ/~%4AuAť֖ Ae)nНw$_"ʀ]mC P2<Ё b ؆qmx`f#DUz̮ &Οm'ߋ3:mqS5xuׯ?Ob!ǹD8|. ;_ՐR^#zlu=e!ytc r< ^ŧ-e'w_]2 /ɯTx_uX1)&zpbŭk[![)nMݚpVJՅy\['qQTm&\5թH/4mlؾvBZ?;m'UŸ-DlEq|.[ԭBՅ?vKxrnrg+ع_w=cZܺc| a^뎕2cplV;EPI@&qI:$,j̗ aӂrMef2~քL"p P*+ r!,:D`V۟`ѢpٚL <$֭uM?;yquad&2=+•;س("2 GT#)[?sN+l$Tc/ Ts6T账?~Db7sNn$"wfP!W",>8, L CqWUn46i=[ Nnnb^@ur#Pk{5~:=,M2O~uZ n"<{1O~uZIh> stream x}K%Ǎ^]J (##"`j0n`F/ 6'3'̼!TI2G#?~_?׷~ӯO?_Ͽ|͏_˟ƽMܛkZ}z/۷)w\e?Mq~w~_iZ/ӧy?C+q!,/sqn;waQn\}t it(ϟסboe){T&?Li_i{{|m kO~oh_ۺ-oa mz@}Ga?_~jk 4-o-Se5'w|_OPzcۛ{pk n^_>s?3{CD;Siw6b6=Ι۷c#ߓORЊ-w}E w8 ؇v#=W$c.'zr_?ɞ܆ô⣳?g=y==<ֳ[ӓqhBp<Hu~_~Qr0ϯֻ:ð̯_0xl9T85g%geqyOp6=U/1K5Wآj(O*2V?6ƨ+rΝIU!~A;$q{-A3-"85IcɣUBrMk__0S͊;y;:F)$? \Hp.4p vy]z2`vf[{2#&f@DgD9 YGBVtQm;eG~$s]49>9>-Spv;-NCŝ[aJFx|f;9=^KKdjdĵsرg[vׇse2KVxVK>IXGCfHmy ױב80;CK:?[| λv&;_0' Xv%Uc\aJNyp[cL;n5̀V@>K]'Ԯ 'wK5`Х(E'WIHpv^1Iݡ ,M&]Cqb6L{ 3+^~͆M%3d'lao^xIlW28#[vaⅅ Y$Y;zc=RO (( 1\G']0v[ *fGНowY|z]Ũ8±;vWGp̺TL׻=t,8XKi`im,l7Шb84c20!$3Œ @F@$@F5 fCVƐ0/>C82)ͳ̩FA$h>% 1Y'e<-w!TErGF8G/lcp22ږGp r a6Z)لB^{kmf s" =0- t!ᑣ|RW6n1Fsp~nY$0Ѻ@Rї(;[kk;M,r 7ڞ"Fa -9tXպR<ډZF'F##QrhfuxhBF} Fhv|RpO6ZB`}|سlJF$Pmk#fs*@Hf67eɽ,x9?k@(Qt"2#"(bDQbd5Ȣ4䀓QTxd5"(ʊ#C(*<2GArDy(EM?EEE0{;߷4KƹvLErcTSPA/SiЋ4i(AtJ:Qe?N-u ,4YJ"2t>/dg6|ٷ3m1nA>-7%J+ܽ/=|ui4$wǓgتiCQ–C)٤tjs8x qKz5qY`"|f;ȟ2 76\(%Us)z IhTɝCqu+D`rlOG,.EPcRjl00*M!̡J>KA+Yn.O5H1ٍ u|+~\˜^~pspxrdgqN hCl8 %ʆK+ \Iv't)o>῱ FK+yU=2\*CZr2XWr)mW͆à3Pۭdd[^q[38"|h8Z$K]63-ʆK+p"׃Iv'tl 4 4\(-ʦKIΘ,WX$w› Ǖ1Y|ӝ';UA~ 8s,zRM#M r)#BN`aƂ$$&$I@$%M`l vY/'N2 -uyೠIQ)F?5RJPӱaݒd0OsE&ZX5P&SJH˂ŔI4Yk|5(o'&Lj4{: J>Ӏ?$·\V0|:+GyDX9WJ^%*Wb%Vo(]M)ߓQ@4ěŀh%NsFа<|}oړUC%pgJ6,N5'-i.d!^8ҏB\nqv) P|Ғj?^48Y(:4[ǐbn9]^g >I-БJ>KX& 9]+ɽX#q*%PPu(>%Ec!OZܒEW,{'v[R"vàJ>N`,DBnNmtٽH#U]dt#U=y\CqFO٨DFqT-9Y be s;ݚV,{q'vR!JD1áJF) a;Eɽ0#qN*FEap4MK>O@,DAyG5dx5/EAYS1(Y"c+r< (>i\^ݸ%@IğόrF>)3y)Sd} Pd @OGNj")%g!xj<2G˚O!x$br<5E`s<31San.覚* zJ^ѐ4L#x|h5>ӽYNNU6}2tסUއcWgcQؕ|,sxMC7x;{oyB1Yq1̨0m%mda W {\jxaHx4J>ߙKs(gJl](P}8v08(.=aejAΤsyAڬȹYﳁZGrYrcGn<< XmdV#C&V2G~k5ȯAڨ7XWz PN8F+eǐ=sQ|4|:&j'C(P}8vaT&Ɠ`49|Ғs>X$g"[Ipr(X x\FZhEExrߞSS.2"s !, XD%(2.s@x8H́lA#Z (ABUd%`,U(.3A keKM <]KAh=TtQ5>4ΒHV9XNB.2)ǯ_y׷P^Ӳ $$JEF@-|KbUHy>O֟ODڕ_å|K]z׾y~9fȁl|z>$ϧj$T8ZIzrEp1Ջ̱eE!]\# `0\Cztz;kHlM^+^S!? Zн+:8oTMT-ٱPukj?v3>VhJg|g:Vb|b嫣g|EPW3&!kհho=YbBEKgB UN7;C)Yv+kS< ׌nrtH;F^w[0]YO׽ xۺ}@tGM: =3P %!PzWz<4όF0$zb:O4U*T4i,?@ze0mY*MBnZoz:!9m:_&?"k 5w)^# %\q𷿼} r*u]/*^^aF&[f4@~}]rREdX,c\aڧ,~P@B%F2-2hmK0([SRo+<87yH!nY)r3 VxpÜCtkPB 0nEk~(7|9DWJh6E@e O]gg=Y{v pٳ W&morj~ֿؕS>IѥGvG6(C>εm#7_qqqg_ z쌍1N;J9{ ۨWsg?uTAq.\^Ϋ)}aJ;RTg|zZELbw\T;pΌtm-Xv]٦j1_J.19F./덭7|C=jcrulambĽ~8:^aSN 'u/&H3*#$読:3''Tt\zД4S'Ew3CHitk8_vZ?u[y-=,n*%_+%ttMbK<o܉+Cj$ԉ-~Z#X:y-hu> mU6;_~=\٬p@jV;h4GC]ΥkWcVR{LaRR<dB_+$~^NjV|L|/{A_Ior#t0/BO]]Jc<q%qd8 7Y7+'m\u,WCm)$}сwX SWpy0[E7 鸅U/H [-Ij;n+v֐Y[.f7X&7S~ Dqpx9Q;=ՑP#d u/Sꈟ; /hY=l`ǩӴ%kUNHeԶ@l_ٿzSNo)f ylZ'+UpB9uIΉvwM'vU!qR*)Yi!ms@l-3!Ԙ4D* FC2ܚ[CA M]XL0J:VeI9`,͗ѧDOȝ~;a`r Y+rg&z0Wn>c|̚uu{Oag6 Q/V@ 'sQؐ5mxV_7ll6mm6nhVy_'lI@l0A heUM SGThh4UKy|h5>#ԇB鑗y2kyL qF^%_Q- W%bF^a>챉;yQzN^>7:y5jvn2txW8 Vh|ڟLRV^Rº7:&e{zX$wbs8ٹyJE+c]Z?+~83vEq rèD6̮ j8p>p=w)K|qK1*UMK')`$-6HzvĥL/4M_^^%nLƷ|KMiD Z>U/`f~;x=Mδ_J- 3w@28*t{~.;&%;޼Jjw̲W,{xM#{xѶiJY^Vؾg]BjD.hy$G>֊FRH z2:*kTǒPweʘ9rXSc7Сڑ3֗kU[&:<}%cW=Rn!{1lLJً`ٝbg`h{I%CKlnjz-tY BRE#jCOz4E à޶!ުӀ4`* NNhzM`U>8*βP1ekdr>F@ks"؉zMbPlUatZarus>SϱJJYIpջ| *LUGS?M{ #%L jɖGEFJ&|2RğqxqFJNM (4:Z|*Lm^2Xo{1~T dW1B`S)r:>7H@[R)BI"JR'#ɰI!O.jz.t۲IiK. %R<3>cD y=.(t˧ "Y~Fɽ4gve0oF!ٕ0pq5"Z4N7| kCXErfxNeKhyn呁FA;lΦǫTZCkwѫ GFxA^Oo|iB~w{*#[dQϐ[Pgu*]) Fvv盀7>A {h#Ԗ4< #hyC䑁Z5Wr]lcs|ۭD݃>p=_$R^zd5r: `(hzPF b-bq\ "p%b (h0+(IRU bCAI"" H\(h&˫ɢuV@|AŀNY!rwB+@,tR@YE1fvV8e NYp Ւt]Ce1lM9=!LJnE)\.WGa%S fH@/Okj4* :FCҠS0e6]#Ƨ E,@A,ƀX_"!P"X\ !c"Zԁr+5Nb}RC}a 0XS259'D1ݏ`owzLt)#taiQ gL!ë aN/)PLZB܁)u76@K0U)qZ# _dxLZB܁)>0E2| 0lx|>ScS$[`L5L!y=.` w|~=:LY~ S0;=^hw 1{y5"Z# _dxS*0*S<4| SB<앑0EI~`dz L0.S<3RWc^`0n K SؽkB4<.a md:L,?)0aa c z0{N{S)W~d)"L![ZC$TMV0E:X`)tk/m1fx=2n ӛ`)T;0 +26ra>S Be0sQ +46h!]:NVƅ#VSJQY0s +Vtt0V'baXX1PꚐ>0oT0,R iU VPSiutpDCBu1F*GOgҦU\& 8Q4&@Q]9Rf,khVA` 1!Vj`EsJp,J6m ^`wPHy@^{ F91 Vb%@8nEv/zcТm(>6^)>/[oOxN m{G} %h~%')d` Ev/"xhP8X ]Ǵ =른<UR>L{agK +[C+9ahx`\4[M@z/2~:),+;b,X/{1|b^Zi /?[G-y̗!fǨ|8of݋?^gQDtlx)R a{^yzZ>aHs8qKN;Э:ӮoϵubZ@R4E& W~)b V|í:^hHWnU G =/R ` KAZ{q0˜{]68Ed ~[U|V'BoԉT"!݃ޠbW9ј:k0^ylN-_A+#5ҺE)ȶ]AKևbՄsDD=~+- tS F-Ӿ̥e$u:x9ة@3>6ΤTn ұ\A;-;Wy "4 sWȟVDqͺ`$Qu$3 "eIØ|Du T0%ǹ$֎: L/\A$^+JJ )w^}E=Dc]:~P}O&G߉[B,߄aҥ Bt0)= _qǴt$w jw̏\ADۦ|zpQU}  =(7}єLB(^A$1H)Ŵ+쳆KA ē%|4!\ПZqZa1"$P\͸Q`v|?V17H\AԮhW3D1 γkD5ڏ K±A>ח ;p9Ǯ :^!^A}[CktwI5]ANa]mȟy;D1/#/=o'KBzKZ tzd5,yƷa.+b^GjܹHX^AD+ l++b~SmЇ\%njT*BȕrHViP*T6\J9 g +0Z#Ips+F0qCUt&n0'RnOڊN'R8r#hWVZ@)\.׽(# R eiM VPAhuTt R8j|:.S\3 40tNL,\V󶟮hkPײ3.V˷X(ӂ|3/?Oׯ;Z{@?t{֭;]9!n[/TMg(mkrn:Viև"w|~=BY}U~UgEr'A'|~)e"RV( 1MJ~˶Er'1Spxh4A[ft7[յSb*`۬&|rG[^5 Mn+~ _ZPse&5,S(T]=޺( cԥbO" ̚U-bHZ6m'v5e_`*B#3K7TA}2uJ^W|]\1!DZ`S%/YM^YdڴK7}W](/͚M^,SdZG]xO|ŵKvMWMW%/TL^?0yI& iKY%:&/MKΧՊ~#@W3b0Zztݫ[knJ^֍H0grK&/ٵ%avK%&:֎*yXlu,{0(k [ U)#g']vix'ɉ=%n)ik;Z_O`& S"}mj }y\&/RD'ŴeF^ԢNg4%7g۞Ѫe7`X}w*㭗a}ْmbY{,k QP{ʅ`r!$ L=Dc.;>?tn{1"~ [$r!Y>ݙ P6ZdY¶5{Qn_ Q%GUOdx h{G屁 5_PƏUWd|՟K@&Ld.cp6pN r0as;apFM=L>10Խ/1& #fCbC7kps( nք|APq q3 LX$ ݢGΚtW1b¼`1b&htD 0ZG[;#zg.j {h33H[1X$jo"S8z~{ VF"_aIHNv[1,EiSm*o@RmoQ?~[mh0;qm| /U\xiC&ÖdxS|/TW*Y'K'/prD2hMzx)qRґR)y/(VCF vbP eiM VPAhuTt ;1|h5>ewk[6!) =W献w(/pۚ2me@ݵ5Cɽ/>K=O"nյy[YV=_TbV/aL\[-L+ϱP;c6yfCNa.2/:8׹oԵ+~Ν;2J|㗏Sɦ{[ ;p燞^Sn[?_׳r5Stnf w.ӤQ"Ϻx̽3WD g!.%Wseop*Y]@0r|~h wP[a \@U2&dhod]t>RPOv5PR<5/뾭œoM[CH@>ت\z>CQ)T?S\(oVLTGy*ם~P/byC(ҹuA|6hC >) B9!,o~"J}^^}LWoePWx ߡ_WY'󏯹_;ev#Uh}]lė#ƯJo~[k}ϬObb~-f2p`る{7|ŋ;H6%+l|tkQl]#/<A\q$$!c2]׼t6Tb @: %5>>9CZܪV"iMltUчVd"@Z*l8o\цQ):R i9qJ/sR+DZU9!ʜUyhN 'iEN::Pr%J]kũOeSD@(uUgD"p4}h@`uN8:.9zx+QNAWɀ:)jn Fw.bu.b -gHM-@z>AO~ywS_ӝ|s6xzӇGa:u 4wh'3SK64|ܑ͕lL'\sSw\Mrm<}$.t 4 ڽk`ƻkzخ{"q^1OB>NDOK !*);v*BKM9-K8x}uhUEHC=;{U# }iG瀷.!|,C[ A!!mBйO=!h r"b}ŁkthgG_/*"4'K~Q]B,„!ʄqiG s#D ًv :Vk QpOx""T Z('*f@X~Z#X1( @*3AMگC1 :z>1>Mmr`]H07_[A;R?δL}Y18N7oBШsyyo﷫xy9\{ɃK׾w2s yeHŶggwٖ};/Ýhx|/vi5g=s(p5Kxt}3ãm"~&ãOWaC\@q%wze\?۾S| K:a~2]]KPX!} =[MU W>ynx ?ju㯢9X ϳ PsKfԊg69;[Lv6-f! wݻWQxZX)|yz۾B_#c:Gi٠KoFYDv9^mЭ1p`c cGe'ؐ3ƯND`1ݗa=:ƭwT+W=0ٮ?NHBqhx}/v:5/d%:8lB`qsAgK` o̖soŧwfOB]Xpvq0.+]u]ꦰ慰̍n`Q&_xb)fwG6$y݁'Yȫ(;*>tFs >b,$jcA#::ff,N6, 68j@pV+Ԇ7D46hjão/O<ld㕓9G s-h4tiꆹТh9 /5/y`3NTZ9Y endstream endobj 229 0 obj <> stream x}KƑ^]J  3@݀^0޺yB{K\k9²o/n}-oyZ߶=ݽ嵁ȟoo~/o? ~o=Cx=.ym]00;ұ/k-h~yv3pf^'־xf^E =U?J ^y[8;\}zwl_>&gr7]|~ܾ$ǎ8OɎg/q8 ,ؿmzi;B5BRHA/p{3{w׽yǛW{- t鴵g̛+>}v1`F~nGˆ{bkoa˓vFgL !i,G=x}z:X6|`K>_/%V*Csкn/ܾ&ωx<&[.վf +A$CSɝ;q:SѱӁnGCKTRᵺtXCvϫtXiF)N|,/?;]ƷR&`ڢ% "I%~>\/X'(8oR b6yFV@oуUh=D rCA[Ա#n\ܢ:r.d)]%OZLv\PtGpj{\GȈ=`<̤(qyZ \Qd%( gW]Q€S(t! C)!jj^ wP;h^IDזspw$;pkOL vuO?L2}3F59»-z`Z;\mei>/m&Oz#o2x@02\)^)ZrjΜ֕Or"?ד݈kgp ߻ r,OPڬU`rv; ߯Idn:w tW =_z^:σkjSP-Ǟk=Y,g?1_Y)""D;]q?t'[r*1Ut=RC#c 0?ǻmsHQ;&]VV 3E%|n2Pm/se86zS$+wB_>Vx۵ۑĄ9rcMۙs-_PO=p/%}{G؆,縝qaf"Ut6 $3W# G(G\_ Pđ뽟 |Ɖ(Rn^4K_stY4ݼaULye0M(pB FcZ0.57(T -UGPe0X\&kUMs|=eUVYtŻ97XH ȿ7r-[H]{^quOA_v=, nz}oʕABc"#iö//0.#ɩ,0bas#o綔$~?4wUtD}sM^`mm#nS.\-xbH2 [_.ĥj  jq/rmz!F&VQ^-au_~\ڡMh;9zOWRJ=x,^ )}2܎Ck/8LPAnEv\js5k_"NpYiy#I+?[ Jg*I.҈H/-^z'KĴ,"p21KǞ=c &5=~dv➮#7-^aԡ]@NG]&kG,9O!2=-Kd VU]6B~{ĸmA=.}  #'?8BQ:o27&u-s}SCO{.5ӹ%cϝj{>WmrCZ$D<ʣ5 @ԡ?x@|2&AnSs'.V&%:*zW Q)8KjwSzbr\_C'86>O^R&=Щ<_+ VܪJz})? ٹ׻wcOً-_10Y$?+4m"\v]d?CM?io>+ӻIV34<7Q=?CM? gevd:r0H"Жn94Bf|Nz8zyH-&mE=đJ nWzQB dM,.h7wKt;z ֙G5˻ڋhjN g d'5sL{F&LN/*jI3 wUq,8KJv8tRxE Ĵ,Q@\n`2Z *@DbP>aU>CUOcIYʘ[_wט]=Xb-])o 9c?6o@#s4ԏ'[ݚ4[+:zf[ZH6pfIbB|NG|s4|I= rռ{2ظkvϜL.ۅSLybx; -oVNlC`O-DRcta^Ag"J=8.B!Ac >Tn0~ss02]}EOFB -[:H@;:7X'xOOKa_+դC/2"Ȃɋ)q ۔vg?BdM#L K ?`y\dS?3!@FTQcN=!$ 7a]@>KxtCBLFDh!ځ?~&#Ȭwr CY oDI@ ms ov= g"#< +R"Mu$iDB9/c.ulGڟ;:T?dKa,PYYnйX֥nN{ ;O|Kkx,.g_=10[*CD$r u(v)A`v"2Τ'Kt&mtӍ*؝ҦnG-}UqF:Ė>|d-.S1񻩯-<'Q[`N$WT䕹wrW^VDFLG> I DBRVp3~$mGB!)TuZW#tjWIő.::rRӑ!H)wTuNYӗtG$J DP`ʊƪ . a4B. x/%t4U55Nf3ߤ?oNFcF;<RZ?@. lYi6ljL!EV#zK3בR}ngz0_dp;LN8r| v샷kz"ƇzzK;ǯO^T]W_):U ^aTRyDPZ+Q ߙF\j\f-tjHF%TxRz?W32~`$I5kH` F> #I*^T`bH#5"Hg^m!2C*!KL&W72ԡw<GևU[iU?+nF"qX:Ł]$j/uۍn:G^>0 IKۤ/WWS< ;>3;$Wv)V$ FD(V-AuʸG_h3+μTGz"gsk!c_{ﶴ>rz"/N')Uͭ|KPG8Qqi3K*vc wc8_/(k2Yݢz5',RؕYCQ+d"ld5 ",~kޟ̥oY*6Y\}%?ps {G vzU +C1R@Y$1t4}әAcq<^GV-7UܷRS'}*^GU]CM&{`FܵNv6y]kh.\"No6%a$"$ؒVR 1DMdTC\n.i6Q pʬ9L&$5IMB)$K$))]\(r*U"AiBƙ55LXDESR8(PK֕ZImSdIdYKũ{BJ w&b,@Ln`2 *@PD[VՃQXv[VGz/ا2n5jVtWs~]>TO>Ttbt?j!?-g6sr#rܰ^ʃwvv-")}V|oITN уukҚ;[{n8&*a xp:O pXMMt}T~tC8,7IF1 H"*amf)CύFN .u|>yD)麈=Pu-9y\+0 ^uO`Rpc"Àt]IEy5"8,˃-9ث <*?jIqrG쐋bUF)< 3`~t5u FnhM1N)%C_,5ǣG<Q)EӞ h"ߐS?5#ݾOٸI5EHLipoGk>2889/EʐGy$'j% V{c`WyVm7I#ms_b^Dl1D=*quTNƖd.z ]܅fALo 9JJ$g g4Y uR &LҞ?Hnd(9ɃRNjR*:\)+t+X^* t(k jj`Uk(>q4qX)O uU$J:N2 S- \728d%8?D|YcZsU0Te04 UenCcgi,٦jnlz<x6R/+`fSv{g΅Fϰ%<(uU3g7g:YJ/|RV`Îͱiga,O>Aso4 o.:gU!'_ad}"Sg) ``o4 [鰰r|ou LN9 ,Ѓ kB",]{_DX0R\@GXdr:aAtXX_a1|IXDۄ,2xNX:a谰&,t-ba!_{Aߒӑ/n 5a1DXLJq W˫)aLN>?RykCMX[%a <':E.C_ jB",/ )՘W(E}KN ,E}MXG=So%a!eО h"ߐS ""[MX O%a!ŀ`@A{AX<&,ƁGb@EBFRʓqX]"ԡ/谰[MX[%aK-fG8aɩaAuX5aZnS bWaF!B TvXhj`-Z&`I :IIuX蚒BBu*5MHX&BהpڢOIn;,Paq*Ra;uOH\ D@P0i V]PSe0tt(#wXz9znbOƂ$R ,@()ߥswW3{AZk)VdԤD[Tƛ_ߤ-`ž}s{\s9=bgLAezlb)uVare&% @SQSrt9J|n0Uaù{ E]aW<P#\@BGAW|$_/"DX裆8c v/) Ɵz,,t b t]~Z-%o] .)R0\u!NG.R9}5h``/T bK ? < v/ ƟZ.Р0t c t]o"1G*zߒ_c?z}S2x]F . 9~Sr  d0fL_"t]l3*z:ƣ7 Fc}A˔ ?r 8> v/Y PnkL>נ' "Dl(*ph]f#_Kj^ mkMn}BnNn$jdrTrC R܈ZrCSN7VФM\šdr )=뚀܈dro'c& M*sIP`BRmYZ~,HQSDW$0UW(fu!F]M҅0p.f!wj:$F,2sҸìm/r=ցIuHF3p.JEA'@cV)ʹv\̆CQ%˭,pJPTٚk@L6n9K$G SP+-!{$ⲳ,rs"A?E0?ٛL1]:PL%[I9芃Eh(؏Lp\Ks˸.;+wr+9n\S} wR~K_AyWL1Eپ.vgbQ̥U[98?8_vgki9 %#~N0_N_R (Juq mc|qI#[98?E0כCT]_{u.;uv+9]1u ACɾ~e8@;GZ,s*/-9C6J_NԴPKRCKT}}[UK֢|}[Sd zTtM׷;-eM׷{0:E%]/Y&&8UEo&=U׷;NsZ[.Y(@/ `LknP2 &C`P 驖]ϭir=NOPJZmWiYOROIr}$sOg*RݰK==b)#IL|bLQR!UJwzzXnJNJL3`[gǣN!U(&-HNBG e Uڅ.3r&&kTi\ӛ$2b*čKda',yEy.Rr[9*;GIkd,7Rsq!ne \@_cNFJ=v^nJ'*Y31>vG}BQ̥]7#IF2p*\r1]{J#rRO5I ~Ɗy>nlީGg>ˍTp2e ؝ROɄTi|zzɎnJ'*YR`^q 2EROT)9RmZ$;`*V$UjkŌT)HtRQ*!=UCRTJ55*e-ZTQü TtMjT,kRRU*UL SIIꚘR|iRSIOv"TRݩ{BJ z&b,@Ln`2 *@PDSՃQXvJSz-r' ((3PpXOmJ z>(JKYt񟾮K:; J+FqJTi/lr5Rϝ*;GJ}zVt;<<0.S/.fk!UwTz_F,RSs1(B.nRcvO#fdJAG%E0Uڃ.3r>&k!UVzd_F,Rsq-,%\((2Uw뭼ZH#V'ٗ˭TpܡiF8*.3PUCB*!mQJNA7gc]2E1bROb.JǵgTiwFZH2rݪRˈVt8P<PW+-fk!U$ⶴCyr+U:7PQ*[B߫U~K~= nJjX3JP^s~UbRxHUߒ#[9h7m ܗ%Nޝ*E+a&vR ]50UJj>;UĮ;o8D4#/2v411˚zlUATw2Y&HFM 09ߥjb.Kb)i@Ll(NNꋓ`BJ W&bU(@/ `LknP2 &C`P\Ui,PRo^ZUJZU)ȌTr!f/ҴðkV_-~wŏ};1qyC/O4C¼ejJv݌Xn-l+&D(oٝ8\3,imVr8uߔR@Q[h7LƼ壈K;,sqBa7Ss=%n(oՁ`ۭt,C) Jc.S/ 3[#%ű[y9hHVJ%/둲t} Vo z|Bf9Cޟ+%}>6<=B{>~sիv }]ꝱlP{# - 9/ 4#9~ViL2A5]Y͡|S&XvRov9/mcCm!wO!D?3Fk|cտ6 vWťK-8rRܒ_q_:\cU}Gm9sМ?şz7N3,`ݧ_L~0<> ԔI::1%) t`͝cKP5܌G%z-Bڊ7bYNm ,Vt]ZW3VYZr:\*m!W{{m۾yRw-_#϶ءlKvSO0tnB^mܱt{C5pM.;D`v@"3fy$Z՚{`{]X{uehlzVlu„#n"huvmx_xޝ&4n"8?6OB e =^zb兞*eA*γP6HBih,o =f7ue8z y =ymKX%+cK/c =ZC}A:nD5J?Tj M npCQT$$NR:t4%ewAOnNE^]ӄI)5%uO G&pT,rc :N|ŗWЪ+$љэkй'ڭ!}ҋcNAѪvUAD;lm$C!%W4YKdkI:q梌f0up֢f 9sDFRFk![֢/tCkz.hW .Q7&UocBQfs5F|t_}q|ZqO?٤ܨad0V%?љI"Ngk'w8؟u_6{;O=X)X_z sDSu\[=|2xSbϥ Bhw endstream endobj 230 0 obj <> stream x][9~7?{hg~ \e PC==2%eeϲ .:Bq"߿?~9=??_קϿ_/iOnO~NOv'Š޿gaEiE][Y =iwªhAbT?wVmkvO?H!|l|hxf4"dX1&4݉YډeI ":!F;u F B~,~Rඨ=QbϻIw 7ڣ{1T^V@w;M,'\U/%KЬ +rY΃u [FWYsSzy!hwvXII3lQz~i1 ^ PXւh!wkL(@=7#xdL7R] Sa*Zg˨물 2A3:k{pw *B+yRfFػW_(@ /sF^ٽ{WIz[) Iven*FRQlu%b=ql.V2l˶CE$1fhSrb{w 9 n4&!t+, $|cKJ! kf P^!ZO \,c;[{9JпNqύrJf|J$5ea E[qI(3bd $kY2r^!#6tv8l 隰};ٜU=~.؛O)>; qRr rzljZ0*P^$%DP0g'-;nk!TỵjnP<+WUu}tꃎW/,~s -E ǷTGRSV})#4賘YP 6#LR]lsx0X ?tC4}EG(\n$}yWR>V!ϳP:@^@rOt{"lK~@MT7voH6b](ǼsgX=ccg >"b\;+r a#FJ5`u;XZ xc*i~R.QOЬns-0ggiZfJ˜?q&M\2Up1d*"[tx;UfU1KsCbˆpѧi͟`oS?. cw2VxhWɩ>IR&/n J F8*%;ٸ;H뱗\bvAHc6Z_*(h 숮l(J3ڝGJl m9:btM0f3 z=WvX`޵DZ_ `(! T%xA^Tn2jVR@'CnN=T.sa-prm1:w)>=}3f0v:1jcf} #o!<)c|P d\WтۊŒU:YZ?7o} i㾢 δZ* p$ZsG %`גߛ9uJ7Z`Snɜhs|Vt$2eWs-le)fM|7b9Rt{rR%46Rd M_0)0~AO|˺/ۼ t;}汭+d^beǺDGXhtx [xݤMTL6'9`Zܶi]_pC`pj.ǰK͜]qKKx<m۹(a% cč-HgZ91-wL\p*&e K=ݍ9Ҝ+$r#[}v㠣F ʩp˩u: x UgAEʐ4vG Q:"iK kQ9t䫚/:Y9#ٯC(frr`ۇXcBt sv5ewUՐu5!ըQ jjjԶ m(j&{~5jj&sv5 _w-ըj_[YQuw9WըF,ǫQk~M5('S5̮'meC~nv+;E-]&ƎJl3=r/SKvS[{GX;PY-Do$> GjcѻfΏ #{!|Sɿ>zS^-ѻWO 5PHnmcxћ L1k u$BCEp^aHMxDO uδ+7 d}[65ڦ8M F$Ww=BK/PQ jmTiY5 n.Q^9R+ >?57iYoHWhȆng7K [f'2"=|/HYȡRth] b.*K+42=NƗA/AFůf; O6xJA-3>qUvF>w3Y*7iODXRlu3E HZnP IIvu)5~W2+!Vq3-v0 d Z q֬avezfZEz}\G孈E\. f,tx}8{k35ur{enPw\%"(v%5[ v4IsD[ ܒׯrR|[O51сK&_1o?pBt˩8D:FkOb14XU'TaE~vt^N l_Fԫa7l;=h8 6X ̕ >w)+=9'Td7T]x;5Hrs;H`_JRnZI!`aFHs4?Ԕ͘sLOH m+NA'I͜Qaw,i\!k׭`EW|vJN^iLRgX-6ZlS !ЁJ5rݼ9 ]ozr+fo,oB,ӳa?R0޴j5Y&VI(S4ģꗥӛ_ *MSfP<82q|X* 4/9um8~u#z"~8)Y8J|.Eϟ4eq)SWRKUBP"ZշJ)y=j3jp3[Yogy}W%8|Qweu endstream endobj 231 0 obj <> stream xK%ftgJAQp P0Ƌݶ 2zDHC=xIRyϧ뿾ן~v۷~O_ǟ?}ӟ~/~r{/}z|w"0s1-R\;vϿg+CavY:ow)ƮY,|]}I}gSn^𸒄 U؍WsZ\~~#H J;e"{^0kW>aj_U/"]V\͢y;i+*cySi6AཏiJjUg 0N{yd"YZ0_cZ@=iYrҶm(6f=\ SWfbwb2& U#ɲ;y)7E->#2o~N.}/OaN/+w8-Q! #7_KuglkġnO _\{m`7qK0Q~w)ǙȎ|SBT+ɧƳzw[.kYz#poLK̫" ;(z)e̒>zR߿Y vXLX5v!m1>#8g38[TXwMETUl O.ا7̟ }w-p=ܵt7k)囯9!<\5.@>J 5k;G -[@5IAK+^*JڜfqS/5)L^8>ZPe붅A@B^Mlď2ՀgvOv}1+5l2J=<ϻ|,4(WJ^*XŒPd/i\~|=~R4 wf  A xvuQ1;'m;tHp݂d"7ᚿ+ls@#6\j8}XJZ wB>LVye.ju axq' tyQT;WI]^c>۫<ܜV~emג:X'/|P率 NP$~ڸ07OjŃ?=XX.O |'_ K]s* O܄(M/X-zJoN[W9T?KW8~YiL*;p}w)B^\lre,8]S 7:Ypݮn- (:c!!<׃ݺ% *\R`6nW[{8wiq"C6R"@O'Ziչûauū?[+, 'ꅻzlRgݧ &%7'%iܒ+1H`iEN}ww\]n!-G$rK%xPw@P/SXl/x܁+R2lftiƵmI;<xbML,{[Y`EX( S0W"|=C.Nlщpaa0Pq޽&p,]rr;P8??Yw6i~M/R&Ðsw+Iq׮%3Z<׀~[FMvdӍ)L]sL!hWSXY%:ɂVI4GF}Y(mދۦ.UxӝT;٠b'Rő}1og#vfmcnd3kwC3(Ĭ?m#o @I΋մ%j#RQZy%%\Y س 6 -6bu_F,vȊ͈Y9k^yJ0rfn^JeTh׷+vWmTB5';a?1mV`UjܧD$vcJ _@Q /T-xޮX[JtURDiߥB7* [%SwG4(?o]Hs7LJ1ӘH.8o17 |S{37ER7nq/n`"!r/l^1~~썼SbWK-]MlY C;:}v* Jɠa"'s{bd= |Tu&`[%T Զc3!R8y9|)*\ucLcj~4@\kƞ|\fĎK7&ev qI&ۿ垥"P(N26hJ@8 aPBjMQfHi">eLd+i Q H.GDKrF.ƎV6E] Tp Ī PM 4 8 Al9I{a@b5 `c[(PGJu(0BD @8\l@ (0}J(mTf$)8siѳ A-j - )laW-Dܧ 㤥p܌%G. `"17H-)D8[ @JF(|bW7)f 5 (vD؄GҟD&HDPFd(UڸmXo7MLxiB%L=m5`c[RקJuBdc2B ǚ琢SSH5"z`2f=ȳsK. &G53p ;)v5FAb 6$V9`pV5%V RPVNaq> K*]VDbnv> ZR4Ѭv)t$*'ɍc-6k4#;ձIefhd+6lRɱ(8Pf pI9ڽ.8P'8Le8481y>m׶w;0jLpS5Xx{L94zO)JQyAA N D A]J )p2' RByPCK  L z%%%`#QJpѤ{QOC[irVJ?h!iԴ iJ-fKZI.Z{ѱ-ZO UQZ!L6琢[BV(t8׼ೆDHDX6Ht=J XW9F%p0 `P0 4E0R800HN!`@1( ܌% )ׇ@ܰ3ET&gIz&"0=g.P%0"2d:8i[nD6z$Jz$ƍ.M;s? u$1)1y3Wb8Ii Aġ )D"bWDt ܧLM p܌E,%'HP#.3 'PՔB51B~%Oֲ"f(B͸?/AI-7!(J(`4T Ga8 3E1!q`Jdd  paDS%cSTc[0Y# Fsp .k+w1aB(]AޮR A P]Bޮ |!/(B߮ |r3@y&s@ ZR43#/bT.勘Uun (J4(@`DSRbCq45 &r`a >Gtl *h@Ap Ch0XRhP9"#[hP6&"LDw4@AԈmTf$4)Q* B N5 BOpM qBOS ӎuA~f$,>wEhhI Zhf ẪT |rG@rgcXE"$"lFd(Uڦz%"L$[Bʽ>"PP%E""d88"lVBڱA>! Z= " 5H= )8Ŗ5/ƿ9 P)ה!d`WDܧ4wQ~vf$,> wEhI ZN  BټDz=uucH;p = &El(UZf(%L$MTuTz"0B I:#(\:#5&U: ]Tf39\ E A C #)!@"`W"@t Cܧ߂"p4OK=@EBn.`Zb43o#`Dt$b[XG^ZBʁg@0A( Bl39I{a@[ѱ p2w8 غ@ҵ14P`&F4 M e`HD5/Y/G(qz\PejL*@TrQj;TeGTj#|1.(TyOnFH(P tXebzv  v AjD_ j֋qus=S;$!e vCl( uf 0[BDN., |e -JSO UQJ!RLcMHPgu!2 oc0h"bDG$&pVw[0Y#Fp.k9tU^83A93R)B UؙAr 93 | OJ̀HX3&s -)D]֑8+{ѡ(#Husz RC?o X݌ 8fKpHJ8p-pUQp!LcHCݎ mC8 0~88L`H$] QC A \S Eî O ]'7#a H.DKr(z]^}-:G` ;}Ŷ P/+T~ B0A[8 l IId0ED> TGa83)0N"nFDm MD@?Uh^#[0Y# Fp.kHt%_%@8`p@5%@R P@Na*HX}@8>&sђAlDl( U郸r-f:XB(hYDPml IIe0 Elp *@BqC0X$hZmPvˊnYhhZ7^[peMгHU AT8` A T5%LRD® TNa O1Ku*> k ]LDbnv>& ZR43&0 `(&@%bȅxrZ,@0Ah-"cq3sn@-q`")i; p@4-UQ!Lc틓Hh4. MsSŎxѹ nL`H:7M9ugsn$sC vns\S Esvnb |r3@ϻ@"} @h-' v `ʮEt(|ˆ{>6؍ 8p8(4r5f7hadݮnA_H]83xR`D dݮ mAp0~ nWD7`.F" ']ޮX Hpp HpkJp8Upi''HpPא tkeBz{ c\]X\ւw&ړW:V 1 \֍`T0eMқ.D|t *@sBuƃ0$y˺?B»1TYa"i'w˺Eݢ,L[I0s|Y"X{۸%p\ P\ 4E\R8.0\HN!@^Mᓛk.21=If?sՓBq21rVEt( ,F ug XD) Y8'TYjI )I;d00pDtp J@iBnx0XRMD Zd0|*Q?}Dtp f0k#A` αe}U` Qo8 Q m8 4%&Rx k8HN! O;Ehᓛ{P]|ӒAi@UC4P%CQPܥy /%fcE_b|P%bcq>6&`aDtp*@#BqC0X$P%"C[P6F &"%L*y4@c-LJ I8Gu&ra:S H A8 kzE| b2*2DFw1 ҒRĒحDȍ\514l e"HdYUpD I5I_ ql_ӁW endstream endobj 232 0 obj <> stream x[K 0\#J  P AE&ك:> ȿ)3M~lxǟ_OOOǟ_/~忿}z/_?~ {{O/I8O>˯w݇'v=`-6t `0juxr1v܇{Pn+c2:آa-)|U1kBZB'US*l S@(}?;}gmO>lI5>~;}{}gud-41iL+)wzÃÍ7f>>5)xzUpR_}Ӗ[߄$AXT؆Oo "zIxϜSnz+3a)fP5-&G2ѐU%ۗLEqG<*NlGڮWu8Q>z tnB7߃$VYNJj?90> v]n ([ίRW2Jx%4;,kL&6J˷^`=9'6o{IДr=biIV,GԪH}UN:kc %\Fө֐ZIZ;qt Ƶ3@/o ڵKJVkJZ-cHc/ 466lJ3ؠqFڠ<3V,.$P .aƐ>5heՆNN¥a NfQ\I;*4*oۋs[a&zVRԀiF0K ^TdZo2`ŵXRĘd'lĹ@Ϊ V 4xXPhP'ZD`-=4=*r2OdK A9!ңL sÂ0Oi\!>ϧO_on+H\/A^S%s@u-oM>% &zFՊɤT+._^7~-7>ZR݄Ly " j2&Zk־qqP-G jZٍJ}S5ܭNWjildyL.8LnIbxS&0i_阨 ,իH,=n(c>vE9{SS^clSk#o@ZiN֬4lTzѳF׌j<6ء]2 kKZ_OMÿ{ +){[I6?F8BV +bPeNLo}Dk}"R(HF\0,b̡22)q+ֹ/rKQ[Gj9WZgL:^4.dRb2ɣ^.QH4xKG\}p"k*F%5!蘰pX@F3wBb$O9BKY(JT:LEd@ #9hܫ1]_KTƬ CEf)Pگ2ˊzgJDe*+\^)CH/D ԗTg() ӘNd>&~^:ЬHlJxBxJrMQFBhC)|l!l٬wEZ0JNMyr6'#ϟnCגצYR.T]p@0[ >O)Ȕ9/JS0 uu|Upe7b㘓}%x#I*-55+ .bE^_'*YR0??'HSHǭ)׃q08xQ QSaF̽Df-2M4#j3 s>ֲ#*oJ37_v6 n DƫHBMeB;12Y bf_.:'6ǥ)VqI\]J*Mʺj=8*Jx>?/2qB.8C*U~B7rM?oxX`ujדkk"*Rİ]JFon7±v#V;͹X봷sWl7"i7Veڃh?N;Pũ-'ڃ2nixW5:q5[\df̘ N"dB4DJ菏# UNE*]#- _4\bQ"֨صOIghxCXM0aXhc1]֤eޢ 2Αa*@'&ϻ$% kXTc~e\%`nXcX0#Et4>GK6Up<\p/|O F,u}(Cq [,o>h o9%SɹZIG|ID7&og4m3N57{O5mc{uЇۛW<:V1CK.d>CEFI[C 58誣2pTڈq:v"/"5絊N;d~[g99f-7e d/o.cropsnvRfKrUfSҭx2ڐoRÉ~a)Ca%JJ }Ğ_vLxdRDk endstream endobj 233 0 obj <> endobj 234 0 obj <> endobj 235 0 obj <> stream x[%7r?SY$#x uAjAGC톀a侜ܙچKSg$f&_/>|_?||珟퇟|w_?ԇ~+[(<|r?믾8xѽ~QN(xËŹ\c(w^.BqkS>^R>?c2r_Oo_>+ݻ׈C_2qsrỿ|!]wͼm[>v#!'8\|\̎_2r?W;GµNߒ+\oDo"_RS6ԄpnKv+53\/M]L~ᵾf7<=K9?J1=r GQt] 沄k͟/??|OǛϦϧ Oqý/ml6Ѯ^=Aho;>3^JmG^ej l_xϭ7|J)ʯսL1C^S!k]E#yE./>O4;G{%>-~?pr/>4rkBF܋{|?뿵[F6l/]pj6Nv[jRۏ~ FtI=ҮKjc(u |7?k}m!e /+e@FGiڵk)[Iuvw{k'Kk%]ӫ *_R /φwb.v}29p[~{ZB<?{IdR MN-r-H/LiGmIăO[ZV7@ֿ [{P34o\yy41;Me&FnܾuFA< yw >OٽgUygiߑ/_e`z6IB2I /퇟 -З?|+͸?GJ.ttT6k{W?"wZʬWU4W0[мU1 `Ye{Fj8`^$fUle]K%%6(^Qh)ä[|(ä|24cM֦9݊<@;vO*6[(ںFtuٝUOBDdeaIC]Wa@#{G]1S{Bj[<V;Of)wC@+A'V8#֕[FeMfrBmS5?;yڐsġ? O 2o^L2w·'~kߋ+Ax.*"ѿ5Y"t1_D~wߚn/5;K}h6_iݽ%/>ywEIi~2\JwOϻo¯o\k('Ow_xxKmV%7L>}L)^ԂִјE,:gEqqeZY(+',ԥLg!Lg!e(,y:䭂Y/i U\oVn=?䷁ϫHVčP iWO̕"4?n:F| P6.~>!et>!벛O|ɞO| dd#.e(K&K0@B:Ԭ,HH==;SUTV! ٨T8Dv $$#8,g;NgU^UAڻ6wӣIUe@U|$YVHZ1pY;//Ϋ,x^D̬A´*&UI~}Z~`E.ݪ,ΪiduZզ"%i#$ !ipZ0z 4Zw:ӣcAHnPQh1$Cl81a;y G2٣*1ُcƀ{4!vy G8Fޣ0iѰ !X(|p!D8ő@7! cXA8Va,Ndq ,N 8E),n ũ,Ndqva1f9( 7d5(u@X@FfE0+P4 Eӱ*PSh9߇i(@PE1hfaQh:VlrS}V5(P4 IttL iX\`X@׺P;M\7{;~:q:BB .,e`wi)Hr%cɉKFFUpiI-N6'q%!<_[ޭ;C~a(9>, %Ǔl(FYj q!hXhX8%`ɩ 5C ~qPrBX@E90A 9dȡ@29A SL2EȔ@ SL2U@ 2d%'@3&Ā2Wс@r #@ 9FȲwflX0X@ :0! x*8ȉ;mC@8! wyȝP;lml w;Br'Tr1@iare YA=G A)r!ȅA $%@.r \=@ W\r fȵ@29ǀL.`@&G1dr2\ƀL`@&W1 w{ dT9wJĄKBmlsrpZ 6'z%cɩKzNlsr(9/ u6'zN%BɉD,9mN @ 9ȱ@Nr Srb)@N rS`@Nr* SA 9 sA Y*zCê8Ń@.r!ȅA $%@.r \=A  k\A V dv2a@fE dv2]ŀa@f1 d}Ā,Bd2}ŀa@#s s9 CA 9T@ L2dbRW9@ SL2UMd 9@f #dN 9@+@ G98888. || | | |i^݆b@Nc3:Bp4V8#+q 58:fpp} gtX Å3M g? gep.Ԃ2V8# gp.o"X8PጎnpF'ұTa,dq +, F5,dq- kXXX]Xa,1G!G0G1GW0GW1G G1GFY?A*;;Baq'8a-(тrPhAcaQ(gy1h5MGbqǑGX!w"MC,8тr{abq':!тr{e h!xiYL dqb, b ف,f9Ɲ,neV弇YڬtO8.+'&@ɊFjp9wRprϲ/O/??|O333l߇l?g~~ở?]8Oo?nWo9ߘbr-7=?JO_OXO'|n]׻y_\x!ֻ!Q %(cx??^d_뫫oqRr^3߿2oͼ{%8 ]Dj&MK ^]-Qzۋ{ BρK|t·'~kys)=o{꥗rryَ=]6K|v>Pdi,Iv0KK^WgJ>瀟k ]8=:L钛5Ow/X6.']v"鵾~/f31^ڥk-Z3Z{k-[{kk[ϸL.?&[iW۽G^d=1ʋΒFTo44-ECp OOp}hKdi&M}ijr77~׋}|˳LhYX\횩7z Ƴz1[m%'-/ÈtMҸiӤ%7ݯ}?tԡ~Vs"/F{ӝkxl{.=&v!r=}'_[__˽6 w glʎr jsrVO:z6;]M ׯzWKQ~N\-EWWӺi]-^K`i؝v~fVj=*[O웮vBL6KQ!o5N=zW3)7]uB\B[t4Kם69Zݜ]ع L\$+PST4u2Q')4_{w]6q\y^wO /]Tf׺7lZnEp6nVUvv-z6IN=[@ӪujO;ݮu׺[xZnNp =uz=ZwzO֍:cZOx!!= EOf#<t:ՏVeEO?UPTd+ =mV94^"8Ӫ %2Uhim44GsLZej֊h-BkLZKgj3Z@S9+iZLSzFsIMuVT 5hBkM \gͥ6UhBkMm:ZnZySCTGkMZKpZh.iZ*ޅy:}\.. ^#^П_Xy߾ m-8@j/ux~dy姸)͸$xBG|=~A"t91̗/v֤t֡OyL6Q'Sw}T^ߙ_`z/0NV3Ih6#:FK| -'y]5;g;wR }[b}˴Td*<5'ѝo#[%$a{ً5mڐE4)jS2-JYQWOfEeYhf: Bt_׏!MUr~sVu~xR^=mJ\N~&򒁄% ]sV@y#u*!8i-NkEp*At;yiJuګ5}ky7Ӫ(/ #fUm;/*gZU]켝q{)1jy]Mx1OcZ>ȴ̓ V̴[]MJ:*/U{Um:F?v<>c UbC89+1¶Cx'CvL!l Kێ?MC6#M?mCaۑ]v!l; sۆ?K:e k:e]w:efߟNن???cw:e&9,dq X\<@Y\dqKY\2R@ :Ճ,dq +,F5,yŅdqKFU#m*hca Y^BB cI cY+"e!n\$($֬cCɑ6ǒ GcZ6HN1/VƱԵ|-JN% %'d1'D!@=5Xr d7%d e7"Ȳ VA S,ȲWJ;A PhXq,\0d e0 Y B 9:RIJN #@<0j;29,C@>:&7ԭr! wqȝ6! w;<Ne 9! w~60#@ #[$9#,@޷@%ȅ@ \"@ ȥ@nB Ձ@r +@ YB@ r k\+dr29\L0 c jR|жpջsv/uGX<ªz66aWh G3TRh:GS<¤lcVh:*xBW3d YjPC@6d YjC@:d)YC@`>d)Y,u`DR 9RKN,a,aHESGL YJ`I )@0@0Pr&  ( sA KQRKN,UaTR9RJNqqrqqzzQ{+#|+}YUz΅B6mxSwۑf'<<a؎Ԓ3Q%g SԬԒ3 RKVF^tJ!*[BT_)&*lG),J!*3/De*lR*&*lԯ%gBTvJ!*Q)De BTP\GXBTR*PBTcS QBD Q:BTR*PlC-T QBDlRʌ+3BTR Qّ*lC-T Q١*l:.QOc,;;<.ibq1#,C,ZGX|4$7ЏxtRv!w<}d1%9 b ف,!pa쮋;!uYov]KlnsSQTkzc^T"t?%P6nU#TG%/šlzOS폵Sϴk@1icQC9*HnZϷyKu1u1µuW1uGcPBc\C[s4G.4.4ƸFsHׅ`ׅxh yj<;y}gUu7^ ]uкZwvѾB [F.:Z7zUhUuWhUG릯 y23ޛT6'uO>پ$#= >ᗟ>˧?#=|y|n^OF{~jZKzʹ<=*ٹiuyoiw$ >۱vI0ŧi/~).LYQ1+jBZ0i<ȶ<6Ɠ*.i>i=~VgUe=~VUmUz/OH *ZOUz*'Ϫl3rp_%b>!-n>!|>!MU"<67W6F.YIK $IMN&fNe|6d8New8T )NkEp*Dt;zT2:M/n,UQ #iU΋MkVUe`CY;==/uaVԴ*PӪ;ͪ<`E}vդ*8yiZ啧iUϋH^vV1Bn yIou G:ӃPo$l߆ X;x8ףc!l0AhX8{!CPnd6dƀ{4!vy G8Fޣ0iѰ !X(|pod붩kʃa8v Te3w; ?m!¶ca0mXCv!l:&¶wi !lRێca1umC6,X)[X)3)0t6 H)0,dq. sY\A KX\ATa,dq kY\ dqe5, dqC,.tp, kӆ&rмcpcӆGZXB^_Br!1iCcӆ* iC`cӆ!iCH, !QC8f9 qrX7DX7 715K1o#@ 9D!@r( CL2y@ @&L2%ȔA SL2;A 7!d @ 3@d @ 9:у@r$ȑ! wBM crGXp! rG臀| 5! w r! wqȝ6! w;<Ne YJBɑ.cw]&*s&*̣@އqL (*2 }+d) %GBɑаP) YB@Xr2\*d) ) %GvA=GBɩYbɉ 0*s0*Y "!0 TFECR29€LRKN2uBM o9^91+xE8 GSX }9e, nc;R섇"vۑZr0*Laג3ZraQjəªԒBסN)De BTvBTR Q:D2E)DeZlC-T QBD/DeBTvJ!*Q)De BTP\GXBTR*PBTcS QBD Q:BTR*PlC-T QBDlRʌ+w~BTvJ!*P)De BTvJ!*۱ n<(4#C,DXqC,; #,] i!xiYL dv&,Xބrduew] x+oO+λ3UkC;VYSzݙc*<!NS :^;L+WYVj*7\dt:¼?z+ɒjjX׏y폮WTwߏ۵uoe ;ZZں1u1u16Z\uF.41uGcBcBcm4ƾh D i4κokB랮:ZuUhPhUuW]^ky{*nj_unкB֯Ѻ]x"U`=콩eb:ɘ 'ϼ9PP?Ç?}|?!~蓶G7ʬG ''Mn?K_?ԇ~zt$ #.;&wi{V鷴۟֘ m{^c:D5?>jJxO郓?ޝnۀҩDHoOT'(* mPy믟Ғ;h A|"$%5c0o;lh$rzYjVr{׻{aӴ%h).LYQY|lwfEm,Lk’ ѧxI^yLqIH'Ut2NTj&gvd|Bd><q>n>?ۍ1HK@6i=Ҿúȶq5ϪMUMK&2@B򒁄ӷIU:A>= φlpZ~q !iN;ix/OTC|ލ>WU i}J?~VT֯Z>`ޭ'd|>duY/GͪfԬ*+PD肕Y.VM[߆UUYUfE5b!"$@2F#!^G m9*ۺ!0֎!l%bk1F1c=1uPeS7 _ڹȎYxo65pȬ\ |ꞅa{ *3+%11htgQ!Ow1ưȻvZ܉X([!nUW/yoa/)gvBr) ?!1v001օ;ՖFןz@ߟzDq=bOa=bNa=`Oa=`/􈹿҅RLw9LrJ)="Sz]N#@ 8`,dqv Y dqsYAł,.dqq Y\cq KY\E KiUX tDgوU!";ڻ]@SCBD 1*D@ܪKB4њVh>0 kUoURBD ,1p@S+ Ḓ, ,,|Sie#:^"VA ;dA eȮ@ =dO }#d@ d@ \Ɂ@&2A SL2@rp harrHC@w.! #F3y膀܉A GrGcr'brGijr'bVPrb>W*4r+JNQ o܉A Y*< m d6KfPr-V L -2bI .KNvaT(99 %x엊%'@fTha*  Sxc0 {vLE17gT,9aȾ(y[aw$nw#U3Y*,55*}Uǣ xTNT/QHUa GI1 xTETg9~ D\jA r".5RhjiE#iEaJBn4GHZ6@ص؊}LoʭH ,H|SiE#4r$JN@HH14;@A 9dl%@2@ɉ2;@ɉ9l9&l%@NrU`@N2ۮ@@f,92`I م9%'%';%MY g,Xr"dvgA mZ  Z_ B ٲ9%@f݂%`@&c0 m\Cl$ a@&vs1 2 d22 k0 @ahX2ـKN€L6c@&}F3_ @q2` 9l%'@fG(9ހ@fG(9;l %@ % '  %=a̦0!̦0KN̮0Xr dvF@ C= C= C=b@C= C= C6'zbiܝwB6޵!*oG6zD6y7 FH* *}/95ISfKNKNk**q#*](Q].Q:J`DGTaԦP0҅.. FTzľ FTzDJ FT\GX#*=`D #*oD#*](Q]& oD#*..t`DwQ0R#ھԖZJn#*=`D FTzK#*=`D #*xsfccqpnۈ~ŝ4. 8N402}@oXQoK zD?⎐YmiY#b~MY3b. b~ .jWK?,ͦqTٗOcXxʀj+f3jˍ*viU?ӪEi:T*;[hytVwtVſ g#du7ۯxt{ U0NxǤJ+]wJ%zUMPbDmF? [2BeRBe^Bej}TfQPrSi.GTf(&,TGmY/ /7UO´RNpKs8R$l.TRD$l)}k(.P}.bD. KT*/F.P֋Br/Q(ԮbSK0To5ޫ7'ƶ4.Y]ȯJ{y_/uG\RpQzas=zG/F_t/ǯfD&`ȟ\t0uzә#NU©:sc9Z=~_ka֝B Mw!M =S8L4t2f}}枪_^a^<О8Gn;o6?IIY^<~:/?QS-?&D@W݇( hHx>æC ?>VN] $`h ayN>g6Nq>Rx3yZ94OfEg,ନ^5-MwO.@6oF{8T*/'Ue)`/|LOHKI[ OR~REKIUX O,f;'$:a^e|B'wۅyVUlgԻi !>HHOo4V)o1/pZ)o.r !i)NM/˓IkOѨ=՟UH^U|0VI(Ҟϟ0k3p]|>W|^o3*jPͪBϝUԬ*S թh75r45퍩YYoJͪ! Iy84py\-QC< y@bMP@7N@[;^a;dg2}Sy7 tcCD1#1q1!w"1 "o7[K.8l6TE?B.VPПz؝zԟzܟzҟjhSXV[] } ??;?#rJrJmj20rJ)=/_NCw9 SY2T@g8[ف,dq&9`,dqN sY b0 8Ł,.dq!%,.dqIC,~1,.+c]b>3vyKy>kŊ.VhjhŊ+"V[" biŊ#ZӊGDtX XTjŊU"V=Z8 bjoksK7TgZζq@Dת=dG ]"d@ ހ@w   }dA  d od @ SL2%ȔA S `A *0 rGij;<u e #C@75! w"zȑ! w܉! w܉X@ *vTZmȖaKU(9Fmjr'b̞Xr(}, SJ{BaSUhZe9d6U̦XrdvUŒS@ *4rUJ9F۪B)2۪b W9쫊%'@f_U$9 ȞUx6VEǀy-0dij,:} #g"P'b3Y*,55b~Uǣ xTNT/QHUa GI1 xTETg9~)D\JA r8xAp4ZnɴZnжZn-L}$ߜ\jjj}Loʭ ,|Si2* 9l%*4-9!43@A 9dl%@2@ɉ2;@ɉ9l9&l%@N2@#'9l9@ ]X.,Pr^,Pr̎,Prؔ2XB#YD΂%'@2۴@@.2@a(9@ e 4rJ-ٻKNL`@&c1 ۸ #IZB@&vs1 2 d22 k0 @ahX2ـKN€L6c@&}F3_ sy%'@f7h! axa# d@ % ̖0Xr"d@ ' d_@ ' C2@#2@@fS,9 2`) 9 %'((X9(( =۸^Sm,z?*lK/e]"@wtaGaw;l$xɩ xɩS/95`Ta䴦PnuH'QB/xɩ].Q:J`DGTaԦP0҅.. FTzľ FTzDJ FT\GX#*=`D #*oD#*](Q]& oD#*..t`DwQ0R#ھԖZJ-n#*=`D FTzK#*=`D #*xsfccqpnۈ~ŝ4. 8N402}@oXQoKIjD?⎐YmiY#b~MY3b_@YoC!7b]6Beq um&SZ-J[N|.WVn^HRݖmTXf[yDEe[y՚b%97QPlxt,1j[[bYޱ42AjVUᆲWE~$$n+p2y&=?Lq=4<W%!T GT 5,M GT > !QQ,TX!7UQ!,T! 5n}!GT$rw_o.v ?jˉ'aKC(ĈڢB B.D81>j 1bCl#jKQ:$=ĈSXyDߚp> U&bmY7~_×__l9<7yc騱w[rH72lBti?n?ldm`?tbZU#߃VGctCֿ'h>LʶS8[CuTgg~kgMCd5uw<iS?~>;csf[vxp{ 6Ɖ)9TV)Os Ʉ{Wjn汳=]0zYqX-vzƟsE{x?N67\R.܉ XuZ93C\ {?1|uMv^M<-ٝ2SsiZK:qoSr_^8:I2ۃ?˿ZRy^O7uxy/-^O޼u(Z WKA_V/1$m,_K$uTi/׵#^T=#uXf+ߺe!lLZׇBץڼM#^]eN2ŏok̺L9nk[me=&QqխaH>;S~j7L}.[WoGJϟs 9]-.CܹY#z?ۤC¬Ϳ  endstream endobj 236 0 obj <> stream endstream endobj 237 0 obj <> stream endstream endobj 238 0 obj <> stream endstream endobj 239 0 obj <> stream endstream endobj 240 0 obj <> stream endstream endobj 241 0 obj <> stream endstream endobj 242 0 obj <> stream endstream endobj 243 0 obj <> stream @ endstream endobj 244 0 obj <> stream endstream endobj 245 0 obj <> stream endstream endobj 246 0 obj <> stream endstream endobj 247 0 obj <> stream endstream endobj 248 0 obj <> stream endstream endobj 249 0 obj <> stream endstream endobj 250 0 obj <> stream endstream endobj 251 0 obj <> stream endstream endobj 252 0 obj <> stream endstream endobj 253 0 obj <> stream endstream endobj 254 0 obj <> stream endstream endobj 255 0 obj <> stream endstream endobj 256 0 obj <> stream endstream endobj 257 0 obj <> stream endstream endobj 258 0 obj <> stream endstream endobj 259 0 obj <> stream endstream endobj 260 0 obj <> stream endstream endobj 261 0 obj <> stream endstream endobj 262 0 obj <> stream endstream endobj 263 0 obj <> stream endstream endobj 264 0 obj <> stream endstream endobj 265 0 obj <> stream endstream endobj 266 0 obj <> stream endstream endobj 267 0 obj <> stream endstream endobj 268 0 obj <> stream endstream endobj 269 0 obj <> stream endstream endobj 270 0 obj <> stream endstream endobj 271 0 obj <> stream endstream endobj 272 0 obj <> stream endstream endobj 273 0 obj <> stream endstream endobj 274 0 obj <> stream endstream endobj 275 0 obj <> stream endstream endobj 276 0 obj <> stream endstream endobj 277 0 obj <> stream endstream endobj 278 0 obj <> stream endstream endobj 279 0 obj <> stream endstream endobj 280 0 obj <> stream endstream endobj 281 0 obj <> stream endstream endobj 282 0 obj <> stream endstream endobj 283 0 obj <> stream endstream endobj 284 0 obj <> stream endstream endobj 285 0 obj <> stream endstream endobj 286 0 obj <> stream endstream endobj 287 0 obj <> stream endstream endobj 288 0 obj <> stream x[[o ~7GoЕù] ."ݤyn(KwJRI>Rs$!?~^cW/=O|_jj_GrT 1&V1m~Óqw];l1`dL̝ilzz@KMr΅z`_һ.:'p396\ 4!mQ5&֢$ߵ]lOo!pnɹ!o4 vNS0 &|# BXJofl-]g<t8kэx=f_xvҋ$-Ѓ9˖8 <֕pyV)уC\O# ];Eߚ{Hth(FAVBK@jt JB͎61qpFt<$6uc0d L,7)}!K>9x]8<ΏьmNY:s`t}"w9,Ҽoz-P4 O39u|2e4R< !ޝS!tNԵH*<CLݫmDN>']OI:tM/d.W/y )mOi$.Kf@H.8*szNkĶg0=hIAamܺN]Se)sVL1 -gj#SnӵRBƼ|9 &:B~8`vпu(WJlsNHx6-hZ\g ;W I` g``%ߛ00$3BR3 b )  7psRןQb,H]2 @{ XŲxfn$iHJgDqp(pcjoLNFɫ$kB 9\Vs'8Ø@ĕIj7"첵RݙK\rcqƷfʸ]Zvù:7GE=rF4BIhfi\h[ʳB}/'KEd$Ul*6d+G Q!ǚ(Nݒs!gTqT1,Ɲ\!B3YяKxCJ5 !:]Uj$|Mad<0ɁjWA^Er.:XM]ǜo. Ø|0@j70-fAdW1' ZJk.H:ZH8TIg\D2r*L߽h[))k[yWug)Q[K"g < rMõ7N{@"hAħҖvJ;m>C;7'IP ƣ&Khj!Щ&%{⽺ZB #wD{OsT X9P7gހgu) GqKH|㖲;=<~(g!K>σQ>)jĔ u HL3KC/Ӌ>#dy!'>^,G~]!NjSTXDz_ lka욵K|YJ+L҃ 1&:Sd#Q>80i-UOa^EdV gdn؛e)sHɉA!a2:9m tCCk pX=8ݛ 8A^[7˴oDݬ.t5, ^[$XuL{}ߩn,]?Խ~HH)bnfrtȳ:_9r[P7_`4u^?2nowrvԟh5JԿeãj] io!QI41'0 cU}7r5%}[J!wC,u{6QT-(,oFKJ\veu lslS>+OѠh=Nͯs{‘q+!8c9V9&= dcO_;:\ʈϲ9>VW#o2/lE 6;2\*ܐ>1lēXD99X{#VBH,6Ww\7V-6[H}HL |٢9r3N\ijI䢾UCtFMCtV'8 N+Rk8*Ixlu' n?!t#xÒp;NAX\;{=\f2k|Bp/rt~Vb7_TFat5N]ѽ~tƅkM<޽UF}D[OgdWf='4&> e<PD/]kҀ|I{m 5?pLޗ!N`6JhLSA&#1m_3ͧF72מM&|_bQ;r5}(KqZ6DžTnXrxGFިHSlrF\A> stream x͎ɱ@ ȁ5 Ahhа{uGͼydzeFXZM41ϟǯןӏo/ӯOO/ϧo߼bOoɴٓi1Y;}7 z&l4/%}ΛhKxXo'D{ŗkIݑ\2yq%/=^\T/~2J7pwMzm;Z}hRz69w疾D?Gəf_;4M_ۥuo8wu)Wi>ʔ|vkhs6:J)jf\c>[Cĺ6ǟ_ ۛh߽%NZk\)SMZ$=sֺziq,MIGUF>HQ9Cws! 1 ':eJq%ڃİCk# E+C{4m|FzdJX^ .Bߒm۾ 7-[/kiZ/tO$tI{?_EӟKaޔ- -ߖyuq5/ְ+_H{ S\q }=۫W΋߷2~'tuZ_VsݨbUi#Pz%PjR[yZ$Jm^W-jdɢdH }2eaMal[UgZ嗪Llګ/*X}Ad4QE~m]ܝU*iJEҐfT*iJERf4t*iJERf4"iJE+4C"PiH3D*\T3\mkas'9v Xx:ǑNsl8aϱpP':vC݌CPt8ѱpP3pcLǑNt8ӱ>#PJ"TjiA5ZP TCiA5ZP TC*AuѩA5ZP TC*A5tZP TWBP !Tj贠Au/Jª;Qvn`W5-)R:&iLb]~2''ouftdA`q}bipܳDE ̴/qwVBN7fO`_[3yz2[_-LPo>gx~jv8S<{F>7yCT;Vmr&FFͳDOn֑DB`=CB$}kYYo!x񤹱=-B΋6]ńѱ!ٮ*x}B[s\?XZU[k?3+ԫlFTUQRleWť ~"G*Pm"8i[a8i^֌ 8y?Gze-{nrZ^U|$ڠUR@jU̚(`VVz?Ҫ=QԏJhYj`+PKVo8*g/WV9:R* $u!){"&+"҃`w2ވ[UNVЃlAV1wL2Yٽaqv/"C FF۝c2Nܽ1q 2{a47,"3UFc4yeAu_f1:Y c#@| ;߱Nw <@|;%)Nw -@|g;:qR:'9,nBŹ,cq1 Y\AO8!$%,.d1@ Y\-@W5, d1^XxX@׶xll OAٜiKqz*"0q7$Ը,9m-%gIe"!q"s-Ƒ bJ K%Ʊd:88tYٺ8rRGlb8.@v rb@v+ ] doA {{>@O fxw 8ޘ+ 08[>`Y g#p ,p1 A8Vva3wѱ8z8G ,p&v(fvȄ6®]΅ɰ+@в+q" 3 2jqL S1*^Pqt  " 23(2@ ,6"2XA XŁ@.r K\A {s @X=R#G*{P=R#G*!G*#G:u_:C@# G*pHB~T HcH@ |#;Z~T H{G~T HB~T0F~T  T~t=R#=G*pHB~T*G*pHFC@FkȌ͎cRM+\¶&7Qv;lw_wzrcdnΜKs@ؖd1%qYlڒ8ft<JNhK2(9-az -ɰ$.c9zp!τ\ȳ1yhĶ$CUCY8yV,9mI&H3|iulK2,9mI:%'YTJN 4sRd*]V@N2xLPhd9t99@-r ;b@ ShPD(9Ń@CXr"d%'@.2zS d*]V(9Ճ@ck\@0@2{GfN0r/̡I99P d:%'c@tKNŀ :@B@tJ .+:1 :9؊9Phйw(9a@t9.HL/a<m%nU5{n'UH~ 1@SC$9=Hr*?%'$ $9ǒS@S$~PrI I4pdO#"[@#8f@XbP+W`n [@ l1бC20+ #ER &01a WF0RE(7ŲaRE(7TQ0@0!&01a‚TTQ7Ղ,2 d@SE,7 d1U Utcq4c1 !Gc1G*( c,TOMXMX +cS@,HYmXeE,fŌ΋XDD,fŌ0X̄%,f ŌJYm=f0GgE,fNmd1ՒrD,fŌ0IXDE,f ŌXTJ9)z>,d1Utd/ }Y `1'aq X|Ã6֣wic _gև[ W{UګdFmoԪ~*Rwj*L56)Z{##j/$Q:NZU[sUkoQLC!RfT*iJEҐfT*iJEJIҐfT*iJERf4"iJERґJu4WNjVc ݄7dž;Ns8ϱ}Ns,8 :GQSNt,08 X7q>;Nu(QJJ8iA5ZP TC*A5tZP TCY*A5tZP TCjA5JP TCjAuAu%<ϧn7y>R}{]H?޾NKrӋT9z7){iI2]_[l7?~/y%ϟ?o|nq &@u6U{A橼'򉢎Cɔ{q_7qbO}+|֤\@4?}5T݄{]~z{?sd4| ';!ǏFy-ܘLZ=U;_S#L\I?`L]zX߹6һ~Z Y?bx]z> RBkڅ4z>Ctߐ=^K3ög)(xt$~4knlNh߆}kr:ڽؤbZC+hEe,BLjjQ6ԚV!ջ:TF^*eҊUtaUPKM_uvan'$S3C:UP _:UԾP}uUQBn}B #*}BȌ>!nO d#/s*;~#2@B򒁄~#UZ)Ug8i NkDpJcd>iN[7j]n-{nhUN #ѹR~~VU?>0 χAVU^jUv*zDOԪ>BJnhUTEjUmyzVTHFt"&+"^,2;7"CVDս1 [N 7cu$e {"^XE݇;G:p^\1Ȱw2I_&,ް8VwH@ں,k쵍с7u@|St07Uu+o*& ;9T ur1|SQ,77u)*冊#RQ(7ف.Pn &9,.Xn b*RQ(7ł,.o tMQt0,. dq KYLC*ZT EA [LowtE{ \ıE{ \D["co8ͤw-pp.h{ \ıE.jo8co8co8-pG[" Ճ@v ]dA Uހ@w dA $ {a\"XX0hqV8sa0,p5= - c#p,p18F8ab#588Nc4,pѲ8:8GGX Į̮u> 8Vv8&îBˮcLNdыLQd1@NYdFXD@fXD@f{a6" CVdс@^dFD@fE@f䜥@ކZD@f+%\A D%@.rS`@.ܱ{!G*{1V~T  T~T m@ N 0 {NC#8{!G*{1{G~T HB~t>F-G*{P=R#G*{!G*#G*pHB~T*G:wt@ |#8{!G*#8{a*doD@.Њ8:j ^#"q&ZYVmwj[!7Fx61  1 "ao 8zc@1ص,^M1 2ƶ$$qԩ^)5\Srp!OB 9gc3̉:"BK Ԋ8FԊ +$$cՙBZaN@tJN  A SAh9%TR*d:9[T9ك@2yfNN j 4sr+d:%T9Ł@.2zǒA S5,92)CޡT@Uu L! a\ d:̜` @e_;`<dB@&`@T9νc{ǒS1 *%ν#@a@tJ .+:1 :9؊9Phйw(9a@t9.HLF|[I`9kw;.FrAӁy,$9U-Hr:0%{T~KNIHr:0%$3ɃI,H@ @3'D!$$y(:Tpi hA 7!@ S=h9F|"40Di`!O/-fݏC= dW@l1AR[@baaB\1a6l1вB#*r80@0H[F0af + #be a - 380sa F0`- #pla`,.d1UM YLe F5,d1Utcq4c1 !Gc1G*( c,TOMXMXL]GS0G*'8Z#eaqt3:/b1iq"3$b1j1,"3*eX:!zTKMq"3$a1i1,"3*b>ToD,;R)H,FAGTIež,dq0 X%lx?`nMuQ>R U4ӖyM'moh"ڪ/ժVؗZ** Ȫߠګ~fWmoժ~'ohRߧ_Te{qVQLC!RfT*iJEҐfT*iT \T: 4C"PH3T* 4C!H3T* 44C5!n>lu\ {Vpc uz=dž ':tCQtFdž ;Nt8ұ}2Nt,8 gB-9H%N !ԂjB-P ӂj@uA5JP TCjA5ZP TCjA5ZP]jP !Nx>5uBzlR?޾NkrӋXyz7){ik㷯-!tO GK׹^"#M !y@BJ_kUuGҩApJBhwqNqZӶpJBdiNjG *?hkbnWkU ԫ*oT=U`TCkyA-;k}?)U~LP*ULCj?TQq}>ܺU9:~P I$#FEMWD$*ޱxz#B>ToET:XCjqr8F^IBX0 7,2U}hsZאwoEe {(#^$e"2 cQxětqrz6F{'GA|jcC w rXA|Sil0YɁPnp w` WXA|Sal$R*&;T xCu!8gTMYLeC*XT ) F%,Xn b*R(7Ղ,5E;PMl(&TCxX@׵ͩzάmNՎάmNǵ)ึ96pms 96Ŋqms 8mNvmswkSqms 6@kSqms 8mNǵ)XzSqmswtkS[ۜµ)dA %.@v -d@ {>@Id9n2,,p8+ 08v8:8GGX cd#&8P3 ca#p$:Fg- c#p,p@YBM P p®]΅ɰ+@в+q" 3 2jqL S1*^Pqt 1F9g) ł@.r K\"@ ȅ#;V~T HB~t> =R# =R6p.HcHHz =R#=R=R#G*{!G:H玖#=RA#=R##8{!G*#;:~T HB~t>F =R# =R@v7" _FhE@f]oJ[ZaMaM&B^ۊ[!;mVoP'O_µ \̈́11K#pmoےL1n00@B: y*L<#fNt' vj8ػqBŠ%-aƘ{"nnP;dA S!(9Ƀ@,IrJ 4 tY5d%NC@*PrL 4sLˊC3Wb sL5ASA SST9Ł@b̡CXr"d%'@0̡SPrL]˪:Ճ@ck\n t9 ȁʾ 3'йw$9x $L 2s{ǒ1 :%b@TJ{GÀ;0 *]Vt96c@trrj1̡sPrÀ;4s\9 =,«Net`jINg)Gx C$9Ac) ɩ D`@ <8$4 $yH CI \ZG9ZM9:TO91@r> |"40$i`HdOw?*I4q \1.IMl1c&",l1A+F07̆-F Z@b!REAn"[Fib [F lapaCla!UrS,[f*UrCe ]` - #b3[F ,KYLeyS-@SE0,> dq 1I88RAhcq4cq4cq4 cqz2`,TNaqFm*+b1$,ft^b& b1E,fIb&,a1cXD,fUm18:+b1#tBo# b1E,fIb&,b1cXD,fU}ވXwR2IYԃ,d }Y+`@88 K 6#E1_g xҶHE%{eUV{j􀗈Jjm.RmiQq]dE*m. o{ܶѻHe7]Emw}`ʶ*ߙ;:`* 4C!H3T* 4C"PiHsH3T* 4C"PiH3D* 4W*iJEҐfTt iASN`s-q79tBc x:ϱ}f:tơc zHdž& 'X:tBc tQ3J] WP TTC*A5tZP TCjA5JP]tjP TCjA5JP TCՕP!Ԃj:-.B5T?<ŧSr]H?޾NKrӋT9z7){j:H~m/o=bLɔ&`?6_|?}%:K4]p<oqIGr6TFKqՂr_N߾__cM%NXm[^GZ7sR&$a6qO=g||w<6!J(V~AǞW폗%$$DFױҩ\AR׼XOq 457cä390B!8i N)["8=ߎU#Ԫ\?DtPݴVAHGtjP+*ȠVUyAFe?Ԫܢ=&*3ZU\m(UԪ2 >1v\RE=pfV8VY@* $J@2Uat79\ gatXe< !u" J8a {$!,ceg*B>`d9Rkɀ7"2Aݽcw/L2fE`Ʊ(s\!΄Y*˂Mct 'HVG 3XA|cz1t ׳*Hw?&#ıPn*6)Uro冪v@ؐaY3AS,7c1UrS,bv@Ć #@S,7d1UF jjAS蚢Pn 6iY\b!zTs, T=FgjGgp\{kS@8B]{kSsp\{Th=NPp\{kSTzG8kS T.@v K 5Uހ@w dA $ {a\rbm aڍn,p`XzZ8GGY c`#p,pGjf#p,,pShXe#pt,p1# A] ]kq|v(p p.L] ]ǘȌPȌcȌ̌8VlD@އȌȌ0̌18&9K 8Vŀ@.rq \A dȥ@.ܱ{!G*{1V~T  T~T s!G*#G:ul/ G: ~T @ =R#=-G:w@ BH@ `#=RA{!G*{1:~T  T~T  Z6B+2z?_l酡ww*|%!vUW!;mVoP'ޯ fMopoےL1V00@B: y*L<#fNt' pj8[qBŠ%-aƘ{ "VVP;dA S!(9Ƀ@,IrJ 4 tY9Utr L 4sd:͜@ Sh9WtJN1 4s\<d:%'@j.Xr2R@ өw(9Հ@.eUA ӱw5@sa\ d:̜` @e_;`<dB@&`@T9νc{ǒS1 *%ν#@a@tJ .+:1 :9؊9Phйw(9a@t9.HL/a<m%nG]K$:BoAӐOۧ=ۂ}w2SR50twU >N}V$3].GwG@'.IrJ?gIr;INvt\NK$$䔀s$ԝ$G>KZKZ+ d@F> + d'9JvYN λRu nTw(u@T.uD2BN%TU'Th*m2A.\adLFP!ȓM2I(Sa*T21L:FM=&BЦT4%Ô+2]L SV2tن2tdb AL SDCW$T>@]c2tNSF.SF e'3t:u')LPF.9bXIŊA%jc|2}Q},VLXQ>.9bEdzXղ8> Xװ8!'XTV8QbqBPW8aqB[℠eq|cP dqd1鳍bqFU℠aqBSSD AWWUbkJKײ8TtXN b$%g:Y,l'dd,bkXle⁒Nj jt~_Upo/vk)7ӹ·)\') ]YuU 庺||Z( rkU§\n[uuIE)\_WU|l}T|f}uuEW *y|NC(\ t!ёߌHi{J5 Ī ª Ī Ī Ī Ī ªCUAUAUAUAUAUAUAUAUAUPTNR7 WܰH7}O{,ɪ3P§7>: zк״ 躯@ 1ϰ K,Vk,^0{M T{U-- ̩o+wӋӠ&.?)ZDZF9@o}XOznkp%p`lַ /r9м԰>~r̨h)?-ܤSf>l\lKbh&a-$pDŽwc`hPpJ$''.v* (tFv5 MbVG S^Ooҏ)?13Ĺ2oC(:oJ-KL ,KNw{mL-%[8P2]x. q$bEo )V5ZZ'(vҝ>(,lXdUMXt)xqT >̪17ڬGQJV/=2bՙ#ggXE`sJ6W]Sf36CPe,5XT}>JOaGV%j9,+ x+5sK,;Vy%EW$JN? zN0,ppѻ|{ӳBk~?:#,y9"aw%OSJ4ϣ<_T{T>Ne~)B zD,Vo1a0GE#1H1b RAo m KRiND.V9>35ȲUm(zDZG{<7ծ·:k TfaAN"%Iiڳobx:1#NWȡshX]0J*Jӭʸ[n4٭bbK#^,^ endstream endobj 290 0 obj <> stream endstream endobj 291 0 obj <> stream endstream endobj 292 0 obj <> stream endstream endobj 293 0 obj <> stream endstream endobj 294 0 obj <> stream endstream endobj 295 0 obj <> stream endstream endobj 296 0 obj <> stream endstream endobj 297 0 obj <> stream endstream endobj 298 0 obj <> stream endstream endobj 299 0 obj <> stream endstream endobj 300 0 obj <> stream endstream endobj 301 0 obj <> stream endstream endobj 302 0 obj <> stream endstream endobj 303 0 obj <> stream endstream endobj 304 0 obj <> stream endstream endobj 305 0 obj <> stream endstream endobj 306 0 obj <> stream endstream endobj 307 0 obj <> stream @ endstream endobj 308 0 obj <> stream endstream endobj 309 0 obj <> stream endstream endobj 310 0 obj <> stream endstream endobj 311 0 obj <> stream endstream endobj 312 0 obj <> stream endstream endobj 313 0 obj <> stream endstream endobj 314 0 obj <> stream endstream endobj 315 0 obj <> stream endstream endobj 316 0 obj <> stream endstream endobj 317 0 obj <> stream endstream endobj 318 0 obj <> stream endstream endobj 319 0 obj <> stream endstream endobj 320 0 obj <> stream endstream endobj 321 0 obj <> stream endstream endobj 322 0 obj <> stream endstream endobj 323 0 obj <> stream endstream endobj 324 0 obj <> stream endstream endobj 325 0 obj <> stream endstream endobj 326 0 obj <> stream endstream endobj 327 0 obj <> stream endstream endobj 328 0 obj <> stream xZ[~5}a@א]vB}0ae 竖ZGґZ$c{U?V|Kq$MV|%.4ɲ[8D[f*i;ҵ!%Y/m`D-60w#8FAaqA `aU:J7T)\D 'S,pGBH]e#T|ȁCI=J.e+:K|}jAxӧ+h J!UFZ'/Ұ O $<ᗏ hҘ )XъnJ Uf(cd=AVv~'#kSkm{nJLoY)7#bM-Ge6VΓCoqPd"VMwLc~iHku[T>luy=&m T ~*u)k=5ORچpkX^\b0-tB= ,"y%;;hUF/X~Y n A^EQTCC `,ؠJ* nl$ZTIݮѷ(fMڌ\Y~U'#<*YF䓛zhIs$'Kbn0$&T3˼΄-[y2֊b6X %[+ذF%\\U(~fBC$q^%Ab#8 3RNτ&˓iLU.|%tc ]㧔:ٓ }F >LlB'&/>,nƄbЩmm`eD>CN$r|HFa`;Hkh:vp ZUqԜQ|7#y @s"i&8yńx+a1bVIĚNK}fDi:E S+CFvRԧf!7!U+9Y=}T [ᰉ4 elu$>PMv59)5š `w &LC:bZZ[aU*لi;>ؖ"ji),|3wq䖞G]d 73Xٓ(iLge@0)GX@xu"VΔ\"d"<lel"L"^"mDb kJĩ):U[:'Wz*($ oz߅O;4tN夋|ڊU?l@;>1^}l>碠^Wfy/ xϻ9 CS.GM]2;46z.N`$]<ܩb̎+SW$ w.ٚ/X"˅W1cxJV$.b?56Mj5t=B9QY.> stream xZ[~Џ ,qlkꖎNuI0nW%w_?}xyx߾6o~ۏ>}cӏC? 4@cko|To7̓B;Uq6ƍa4txyD[-v5͝~ݩWjVdtlU 8:UH}w&Ν VNh[M@*|}{+xֶ5jʇno~i/_~0K#Kl"1\͝7j}$_O,ڏßFU]#-w*\cTgFA ϽzTրBy {9)v ngv00X4£!}6pm@cGEk@ʿ[>?%xHP !xC0uSǙ6uWu-c%fr$%ҁ z;p#@Rc{3O$ 4g{Tȷ ɠ zb:)E*c%CmCOpFzSd 6U>*=zy5f$!4mߣczN bjb:YK*YaEU:*gF\#){)-ufuPo3ˆf'kQQ)_嬲'jcRkJ٪R\*:Bog&:N 1&j=0 gN X' n0>-u WAΜrT4"0#5} (c8Iٔ׬@zI,ؙܤ^ BKEFz.qΑEwG**~dÙuP3@5϶3P"9Rz@ TW& Y,mwEH5tHNUGj^ אԍ`X$r7F\ƨ_ܬ:kũi1.<`ǔFr\>6 x(](nmyAIJ0JZ?3s8{Q6;NK?֑:;PÑ贉'ֱP >wbߺx7G*dA5zfjE޵D" ɡ^k@sZ." ^9y~;X'Ikb zb!V|w_tXuyU4rs $5op]^.N}:Υ;t}cs„-Y#,'l\Z6 "OT#ǔx:๨{Oko͍|D\au2iQ'G~0=kU9cpH]P4K̑eSHMEp<q/ie/HW!28ٕ*@d@Dz = 5r"˦hg o|(]@ޱM,vr =q7j2:T`)NͶx چS]]uTv!횺yJ-IMoi7@/A4?_4^0SHmeU= 8/ja[)B|8_4ra{x3`.u jg/EֆL'0׆In.\*qX^??xL]_WZCvC4Ncm`d)1[mHfeCf\@SEprs \NZ.(Q dyw'OedJvO,VD8BCG;eH[Q‹ ;hu:Ưvb͝Že^ka?Z-)g ֑ { zܔSZگUiQٗy,;R/{#*&3RwzS?PFeyJ3-ݫj.DfV P.Hɒ8)rOS+L'>űd_R*d,iu,mrfR2sĻs[Oݘ|L̀9q= "N4%G,)0Qmz endstream endobj 330 0 obj <> stream x[[o ~r3 kѢDE<!v(KfWG 'rȏw}Om>y}O|oM?Mp}u;CW(1UQF7]_ /Ww Vz[lAY=h"A)pk뫉ZӇ]kly~ݨwCxwqdk}ѸPE߀0Z 1kBܞ`jUtJFۢnVOWgm\ب/|fqhn_Q`o7ud-1qL')<||AKR`sױQ Y:lVRt8zl:4^`A;/Y4}f5T!ހۘVg nBbz[6$rTDg)N0q;|p9{ =\AAzasg޿-4`Q]g,bTրBێS~v,; Ǝl%ϖ^2-Dr=YyG+Mb-䇤Od# k-Q oۗӷݎ9BXiF"nWz:'@[7]|Lw!@FuĹ!UnIOD9B[)vVV4Q&9@n.GKt|Պ\Zlx&Żyz1Dh9F &睡dD30>nߥQSv8k2-/>Oɂ=̝I1Nvc౑2sGkr~$6}Ts~,U(&rF"`x(w[2oӬ,-% ۢ7IpM&N$"ݖ%-J%W:x[gҝ pUul4# ={@Axz^BhPha26vRS]iFvI>]"]Ubtojі]nE$y"˭hY+|h?EYv5jDQ]2UMv,'=E[rF:}lwF Nքv0X/Jَ g녞^jRj{_D"`i~Rv3w+D2Od9nw9w`޻/7dp㔛xf`kOݕ {G1rHO%G^FLBOj={P1[`t!FU&۽.ϼW&DJO,LX-x׍fV!;tZNIPE5do7-;-KFFM՜hiP Oa8*1f\:[]٬fL')twl)ƐurR{RApٶpʖkYԊ Ӫ}nR';^v۬/;kCH38Fū2UI'R4}3 .Woeɢ듉Y庙ϬkA%(>ŭ3]qlp|erh25R]G /^~aҐTi-l=8e^'yN}*],QDGi̷V|bKUғkIRn*Y/Y`RSnkoxIS5S yZDHk0!|/ֆP~ rN U*{ʨL8/}K w@ȃܦn*= AJ diBm;W9nN s{v.Ts;2ҵ휀n]-ruagQ- U|}jbպ܎Bf[eO+394)rӔY;0i}9ٷmy!Yyxq0ʘu♃ŒyX<ʍr2 C4qC`CnA)ūb/möB & Kޏ Tij;eWhJДyJṊnfDXK~RϘ 9s;$y R;#%Niw q]:ƚdTuA4c?x-Sn}KԜU%$+iseDgM vd#q[2]-[qN O~ςi^ Df&tte-.nGC?*B endstream endobj 331 0 obj <> stream x[[ ~_`Apnb] [̓:ib'E}IFg$3[wϑ8#9~~^}g?<׏߽O_ǡ_ghb4*Z_TwQ7ne8|T˟&:*w!w[›==\Æ`*ѪwXYZ綌5+NުVEThl-&nn~xoOmuk0`ȏ}L __?Rʱ̱# trˇwvZ܉yI(eo?u;h.>zwNpz6 Qua:NJ#``z;Yt7F)=gV~Ug}XqQ^P,Oh"sp7$p'b~.д6b%締XfO~a!?>V>go һH,nOHSGI:E9ץoBbyX~4F6R܇?HSFy$ZV{T @MԸT9FoDGc@^秖Qӻwnc~5s-\ghưHG+{}xq i@I+NG}O?5?_\a#$k>FUjG>IhvRwNY*=b|]1 q U kb`5ChC #eZj ڸUՔ7 eɾ ]o=Z$h`UHVY4cr|408I0}`ͳs C k6Z,PW=ef@AVYfō$|= -9.ꡮ"׭OB/j/T9 {m N)e^pŘKzw1{z~ !H vO^V04@$;h4sU4ܸcStfFFaFIgQI8cFKݭ'pFv31F\y aJMXꆵA#>tFKo^]hx!A(zoUvZ y*xլ 22:$ZB ܐ]#I0Xl2<\RWِ||C&zژp'ڕ|{$eZ*ׂ-rVt_b :Au_sM٫j>ZG->Z?So㨡ZM mpP^Bi}GIITaXs',{41NR!M g% ׭ke"ZɔԳwMkKH|~9#ɥ_zY}A1ZO;TcdSh 䠩yZ#pZD4my=3hkڝ4Uuen4 9H랔¼P\)IBSr^U cbW)(RN WEV2S"/_hY2|*?O e?޺gNK20Z/rɋ u$qrԊ|Y(B"~]Fp"ńZ-HEASN9Y~?J#yA%[_Ni endstream endobj 332 0 obj <> stream x\M /3#[`EH-zHsXIC6M@_JlI)ϛAdG(>$R>~y~~>ݿWӇ_Ӈ>ӧM?M훧470!tLcko> k~7<3FG9LBaN1qß߾py:^L'nJ?<>2J֭gdtO;*֙:WITkӌF9JX[ƛ߾h>-S危Vao~_>g Uc Z#egb7V,=Hl}9il_>~yӻ@#Ql@K;-rg>Iˆ7fc1 0)fG:15WAar4|!9'7άRߏqlNg5GaZzOb,E&_%s`oup25ubdҸõS:9cբ]^EZp;AvuLR˨:x6UbZeުKe= ^`f KI#R<"seH":ήUcV o uìךNF"d1v,Vr\\%Rt%bTQ@"y -hFϟB \#ץ|3S+L1{kB({:EGf7 1 l4y.b%Y:Ckc!䵈i\> OeFQ`TC-D 2Kx B]Z:DMDHBS9+{RsoIyKt:uF ."+D U 'Hm"Dm4b[HDJ)3; oX r*ڊF`2-IMlPXЙ&|t`*`+`G ET&Ыj'"l&xp@"%/Dҩ籈u> -ZB+ͱ T&]ݞ|T^p˘ HEV'{9YJc[C;|"i /WedW:Yt%f]E')=f_v-+eorwan:#}}4<(j0@u$uS-K,Җ5[rBG?v [i8it0;LsaZcKyTBje彌_\"0ـôe/u=coSN&R*Sl_Щ[(<,áj:YFM4~jwQ$):#Mo(UĘ.7 PZ후\QX,t|ă{)T|Qkq s srRћ<#vhlPv $26H謞꾧ްX(]*3y1 BZm.Y(Yc!(*wB$ iv25\d!#c$lv-/FE 본{ ,,0|kfԜ'[0/18wҏFB*th\hRyρ(GPK Ji~y$db\Wb)Qd 㥹j+bD^GQ͝ ;Usf4wjWB.탘VbD^戏SAgV&}z&Hw{9uվTIOmE_,,O(;ћU؜Zpqg]0`b?TrE,fFyf-g V ߌEMs@{ZS^ ,#uiۋ;ܭ ?|ա)۟C@fXXp4Wllծ'8*b@LɰPWDyuk̑YQu ( x r[C2>>&ڟZ u A($jU]UK3ȱvEkIjha8T1v,OU ̾uD Au "fK3Ҙh٪t19GXq9 Wg5JcK08",Bp RLtD p \ҕ9*h1,$yⲶ~YeX͚c5GLY15BɤR&] ۇ9#gUNcgEK4`4L|T +A_-jfܫq)bcH /l b!hM?@ڂQ$eI0rFSp^0֫p[[a79T`[; 7w麧[}́AgxG] =c8wn&ⱆK4:ױ5DU!U!n :;^N=TL~i81V (گn :ְк{:YT:vBF=TuҨb%F#P1usܗGu_O9^nAlr{Mի'"deͼQm҅e֬:&vad%O0pԆ ;+;YR8AL~M K? I pxZmN̽WRWldk!3?Jn~KiɅ\hLaunPk0;Ex l^{Ν[1^eMudsh&V; kb֝M9knr($E\EEd6%$24ܟ[97Q2  G rM\eb:ߢH3[W(Sȗ볿}$uę4^4fBV6hh*Ĺ7Ʌ>viPk@5O1YǸuF$a,wr=7eq*wv]&3B.wD2~4oHܧʼxbzgdDYˈ${&&)pZ(WPZrq2BvvQmDl^uڅӡS NRbt_o,ԂK79-YG f<['FfGV꜔:n#!BuuW,]k<={&禋=V.κEpp, ew:wnŗSmwitiD\H^F]7%&)Ӯ;CtݴfQD=#pT{ZETXGTʌS5g$!Nt^l1` 9]``!9g.:puW:0Z%U _;>>J 3%-JX(lU8~ЗWʤCrTRJCB\X& &¡ΡS,OO8wN65+Ȯ~B⤒oAHz}u'"Ꮟߩ;V^?noY7]& "ڀ?(5 gafݯ/4D8jkW LfۥdhEЗ(V9V klha)J:pfZ%RG,c!4R=Am):tZ(5dӫC>k85i '3Cߢ zjgzGz)*_#;CF Zu^\K endstream endobj 333 0 obj <> stream x][$9r~oP/Ӌ;[PUYxŽ>4<`L)%ef(,s)e(/B ~8|8}׿ç姟_t˧o>N~|N' 1(yo'Ƿo> mF`(G}u>+.ʎ aTA_.\Y=}77jN6ime>wx^>w-em|EY/т832rq]ƌ5cH& ŸL0' ޾?~g Oۓz'1iȏx滷oN?_Ovx_0s,ql`pZGq&aOT#fCrӇkx 9$Y!Ud(BEUW+h% 92 A16$ܚN24]AFsM!7{GZhL.&\J+4#/Ճ|j{SӃb- rZPFw o|rtX!ځ`pw V)bKܮ7aCMxܜU9L/W]~O#g\r΃\ꦭ`-ΰ+⦰?w O?phh򪒕^t \](v-]8Pnϲ rEq#3xg -ϼ%qH9?SS܍\&-exLGOKPK%nF t*AN% f|\0Jc Yv{F64+@+ctYP51"tC:Y La5o7KPUS h܂EmŻ`jÚ=G c0Z+fr<#řX.N@<5:-YNpkӝ@9}93ȯsΪi.?%ٞʆVJN'U4k^i dMH);>ZF1RaSOo`ӗϞpڛ[ *c)p[ aęJӎq~BRRE'~B\1/g}p`Fkz+^٘*vr{G&m|eN`2|`V<` c7>%%2(]1!4;@ߒaޮϰmg+-|VI-4HJ=۴|΀<SS|6-_`c 0L…P<[NO9Z"\iGSB`NLn+fݒs gwF1k8~`IJZ#6>?m(>$S2iңQ^#9;379Xc>/IhE[EMh? y;I*+;Bo&{|Y^ls0sb?ZISKoA?Ǭ䑎ngmQƱm,}60h{X$bx!X vjsU PlZ߰3s W]xyȘ8CJI? M(o{=!=nw3˅G7bO@J|(n)oXmxwQܴGٵ}L# ackۆM߈pT?8^"N3bFZB7YܥL5)B I"oBPwr2N0NMv/^qi eX#rg[V5X$I<|Vb#a>)*ˀЕBj8bu17g>ϲ68ɩS]]ˆ]NGu7ν]$֥.,Gz'U<"ȒĠ}΢O#"f5FPÑI\БA$(]6G)z_@(WBXܱQQFZXV; -k@jk$tnL(tQd幮dva_;Nb3OHjLqnHÃ'̀]g$F L*l堳У1pWe?&'9ݫ񢦣@5-r-& BG4@}La ReVNgͻuIF2$$R7pus3y;FtXLN:uBcYR)BTˀ 59Rܓ_B, _( 6 W2OX0q 09tzvw0]UaUK1UK8;Q2 "dUxgs΢\Or}ݬTXq^4S2dLQwՅW ӝru~?`f[.c2_֨z%Σrm啶hX)] ^,@%TGyWbl,VWSY$9/f$( šV!8ta kE<8PS|@JkRwwf%T@)T.<&D8*ZVꊢR"#xD RD(0*RD'*eD[ jҒ6ڙ kw@ j* K5;ntgcj-Y7!B3Ti{h.&Fd]&WW6j+?V }\yM_G>s/^׵Ёb@5>QHs )|}VNQ^w=s:MCЮt:n4=nQLv+-UNꆔ#-uz^7 9kue~A{L'&:hО%UDAI]vey@Gt<vf)$L.T1>7Y}l-z ڰ^8HM8a!3Q z endstream endobj 334 0 obj <> stream x=[%m?0]+Z$@8胑u<Ĺ@_i$rDi,x)Iӿ~_~7|z~?ӧ_׿o=ܞ{է7~+~c&3{ݥ}w_aJr5{w4i_W/1_ؓps ȉ9]Ň=`Ȳ2n])իU'sNݍ3Gvg0n7ĝۿ~zK 4ۖB^r52]B6#귪Hw$SQt,l_{zcU'Vhtŝ|,I<HI&6ƩЪ%i[c!J5k#r7~vO`w˽OGX h{HưyNe|@4󌌥hSugW(cdy(c)`Ux M-t` 1 1boJHFcaM;!-Ҵl 쑤) *@}/w37Qz7Hۣ'ȞSOvCsL5dG맰Ù4 wY;v>s|WgNuO  /a/F{q)E"I)=BPx{v C=FRKA4vb*[9LM҈xKXVBr b7<NV9iV\I%&-Wҁ|J(鄂 b1;X-ѧVDr=;~9$ 90cY'L*p^ eQr Z Uy=ͮQ3{܆yrw!{~#3@ ~g M(Ӣr<3q77=*ղh}r*)K]9Q$ ĸ! h<*j;0#w1 GEOt> |t,Q(~=Gv -L, ;хqITSwnII%S T`:J: 0F G5N,~ߞ#PdPnpus9\ĕ_jb``wƁj\;M82w( rsG*ZE10Hҳ1=gEBx >bE9=R|'EfbK/kUW 63}t $qw&O% DF8T`!qL:0$Qw6w˔u`42V >q>e9`H VEi]bs ( W(ફ<eM>-JW,ҁ#*tqD<+hM>˲ї'6s$t4{^<>_J`dv@){=B Cd/bCZd$+Wpˌ`Qs'^Q܉A32yh,|[:,2cBF]"k"n#6Myٹ|5 3K BM܀Ncu]jdm=tlX1e`'K&J(F,aP<C}u7+g˵+,W֝Q:=fP!6kvpjl2"璹-oJ7MUldEdQRYWiBGӄ-Paӄ 4 i¤9M8ݲst5FWt9dV[[g3_'Oqc1Vma)k55,qNޫM3po`#; ;injλX1Y٭i`u\Zئ dr22*14[-@!qVZG&&,-iLqfD[ ?O% ґ-V_}dfHU.Q谑ټ,X1[Z-aQ,pe}&Kk[G&F@2+@soxDh̦qD8z7Ez!;e @fmn| NDkB8^i~@ LkLf'֭l9= yTdDj{S9رr)N%Dkg خA gKӼ˫K7u:x?t eKVjsŐ lIl q!*i노Fg)=ܛ/VTqT4a{:rkU u 9jlAl_ັXrMv}o-6Q ӵC d5C{b gJf@cwE;5O\=_4m\:z[{NC׬(&S= McA5peX<`=`X,X{8vl͈9Csv{օsaFc}^2DS1 f8Ԥ C +6M?6mT1Y9N ]QMpik+ BҔ Choݹ;mHޝ>USl=JVkF/܋5މ5tE5"AF`W`nb !}9 di$an`bYb*k>Y17K$(f %(Ȉ%&>G= ʬ0MBw5ܭ$a0ˎs-=)l?H֙Fv^ ݭ"z~ë(8U5$(DUb&<]MC~pdIxBMؠ$ch"c 1&%e 'lX ^9FcKO O0`<]Eњm')o{:'ÖvHUb mX.(*L]E$|4as$^Fc5p͊uv@WvC<~ d;>.@ Zh}sC\ WQ }JWј-Ug5^A)gγZ)P>yt7%9Z {.*M>A֑kf2]GPw[@5$rڥ[(DetQ]itt{-|HSVey 6U[lkTup5 c;q@ THd@P "6Cn(D =3KmiF`dƆiPӲ>^ p(*^+zX C,Tl/=@10֝->3BVKV !U04[_-@5$Uޡ!1v(8^ݫs蛮cԀY? + E!-ذad 9=kRPѪF8$+r(;FWJ3s[Uw{!MRF8zv:4XULO=^\2f}"&j2]P!j2U@S%,DMÄ\@2TG #c4{bh/ޏP5 L05 3TaMÎiPTMÄ\ȚO{=tMCԨ!-1Pk (IVE ( @4,K H3Bދq$>HP9_er|Dxs*Zǩ.j j07zI5LRUWiT*>DYݙ,a.y".a]Dr)-ߛGHA4^n]k$N=(PRUlr-1۴iƍ!z?CR&b:_BGVy;Hǣ\0q5$ś[:>3vSm]Yx4&{|ANcv^g %qž])~^~lr^p`t^a|KomMo;yֶt1= NI8ed:钄ք L@v^^g&e/3y|{g؜%2[<[-ç;IMM:{{f4WkHT*՟~/??Cd)GCύ,l#5tz]%9]^lVhӧiŕyx0=ĦW6!oB`p $Dx\Яbew& g6f1_iL3ցVTwOpcv =x[,p~uR4o}$;TN8@PT{ج6eA}Io\rG θ,yzoesG1CNbߧA2%JYcƲ)Odnp?52//=vao1і ,3*se/j6bD{lruhA<]C -9Xk~zvWK;B][uԱ33#; 6w_tKGv*|{e"=峼Nv R+Rfr˴.1E y~Z@C<-(~qO L.&a:i4CP$0QO L0Af7c"ʙ}‡O 온2%fD3P<-0$T]Y;ZhS^9M:0HXZ1+T^Q!xXx FI&УsD2$5!eHB\2? N ((E aȡe3H3F `豁ƦauT=0rPG`b4&VW_NO'߈&0ZUp]n+xg:}ANM6֢ǰ-?ƈIAJ}?& "6ʄpY;7'Ʃx@>?QY;ҤϧCvV;Ks9b̜hz o vw56v2#dXG7?cxYK܅`vjx tze {/^TSP1M)d3c:ƒ)0EEo n*LuCvacM#o=hI "# q̔hMtXikT]jjlKl%ˤh#16y= -E;8.04ܕ-Be+4L"YGDhp,oXg r[Cϑŵ_KvPV${ɰB"V cL?meu AJYWu)/ q&KwVT< Fn1ZحvQi,/X&MC\=bX JO҈g3+=챏r$K6ō;M]w4Py]4\7*% jk>s&)a8.i`%5s/MϸY= 7eda?6p=Kv/{L ʦk!?] j +hWs6f$^IBSKhK9XfDqM  "ׇ,X]o9vT};7H(LώDm`dpM$ tm׈##B`TBDVN^RZ&q<×䈷I?F%[#ZYNSK|6|2R6wSkrE&!鎆:$ETDf8`SxKE4G)}v+$SkUtv2@ar aY"顐)@Bֶ9w> stream x][%q~_`y 0cx{y̙1Dl+[X ȿbZd(aitXb},^__/~O???Çt~| ߾G/苶dooߐOxFnIK7'Սnƭx2hD~ىıBj2ݿSw^Q/y* m2T< b77EMG3zC$7RbDx# sV.]` a_x?~w'.ڨ0b߽}7o.;/|5fk,颅X5v|ӝff/om]֫ov!Ij:i35H}#즈šf{^ָ,"azu5BdDD_nj-T\|hsa$`s2e+1ǫrhq~2i xh4ȦkW)mGR}8}, TR^E*ȣ*DL6g-TTEla,$srN۔v:Dw〵M)fڜ@dEaMЛix~ hϨмČ#)2'ٍSƅ<4&<}J^'f" c iE?5w gէ71h3q%8jWYH^$uPV C^)${}܎FhkݫL#G< zUAPqBM%"^f&RaZYp s:ԑvGnJpTGr/އD(ȏ:Rbʏ0: r( Fc72UppS;^~F#!A:#c'ԉJXt#u"p7Un6HsEQ&egREo!ou'Y{IG6?@SAvT^р'Ec:lL#BFrpi5Tf< Bcfd0#r~bm/$*Jq00da42񜉫|tjK&).M*pݙ{}''JşKc/^k%gX"̰ k~$a%nΰ4!+ 6 Y^'?1?'g >liXߗF!^0ȧaB\js =P@Up<:/FTQl{ƃ[R?\VxୄAo%L:x cI[&-<՟%)Jh@H33E|)9El-۝ c;xqf)GܠBKIzP`ەa|lN6CW_^\l^d'l5xbLMF1Q(^Q9x5 X(D vu^gp;fuzT%fݽmGV :)\1Ϥ6=OD>7 3@707Z7vj /hHLZOxczuwЪjyEg<@:QX74 Dye"eHa*|+(jX*F@0P8)UrEJ f<Ugfu#NӃ@=d5;\U{ [5xjqdO d{}(& >*.hYTr 6  V~y9KR8du7qx d .A dGASiH.0^l͝Nb]Ggӭ;4g8۔pK\.MG"4|#/aֆKPkv^?6@>)nΠ[ݙJ@}Mc$-nBJ;A@s06̔`MRN %X Jf<-5rgf@ro=,=(\KdU*,o^W$1*qeҊ/G  0ɖ5PdYJLz3%)aMM$+É eM@ȎlA+bfJ+wϔu c)a;Д9gr 'g%5ORP΁߽cPngЅr;Ck`r}& 8UHr'!1hFF"$%BF 49%:sͩsB$r bsz䑛؃*JT3u)z&d >Z':>*nY'2E=6(|gfk*)qJS9l@[}mp ׏QU v<&o*_7+ҵ:>6t@]'nrgP/X3RZO܍A+ ׍l>=xj-A[._Sp=Πv&=0$'=&LBYpUpv+xX;^W"MH"TP ^CZ 4}A]Pi@P=F҈8HXjgt邰x;r{2BhvY`OP?8pz<̞^EYveQ6w3B,^Q g8k8#R݇v1)Y4lf j?n{36eNPWpGv%M~>x (?R* d]]onOnMeGUdL}s*U<A !ܐbyC4O Qo1B._WW +9+1;x0s/n?oq|𭭤;#i͘+"K%R{Wԏ~MphMPf57iS&5Wܨ ww//&'_ߺLEH\SzJGV e@͎~3?А+q-JANQEP.W /XiѓЈB/N@q sä fRR Rm֧U%9#N16+4yY[X .0NMӀ"*̑[18KY]xȐMX Fl* Йy8en[اg|ݶ˥'\:k\,ϥZE,n\rF ͥA)4"tsiڼn.\w< 3s4Ne f\l-62K#}sJhyʘ9/c!_Ʉ|C*I%jv%@+ZTHCU ϓB1Z 8H4ކ!hvÄi߁i`ih|~\E@c8^ Siee6o_ur1$1Z@YpR\O4[}pC÷X n̚57W<@As@)l!`)M't! k^w!`s%7v>܈4h@TnP +=ЗQ?Mo+f+UD??e?. c[ w͎Yл7atٛ!p“giԭmivq!g8KUY8Nidq§.zX)4l h^!.& 3ŪN֊}^Ay`_a#˯S Ms[<=sHbw6Xzި99(gSGNxzNMϛ+NЯGрƩfe=+[j_RضmN r f0@nKf8u2jHU%foLe/a*ϨQOaA m* *(TX/W;S6:vhՅ]pBW Cc5(Эw"5V32]Phِ gpa O5X@Yuo88n3ubD^zfߞu Q v6ZF%DNZBP ]K9E鄯%%6&|G6buF(Ҹh(a u.Qj4 s*4s**-ҠbmmCX$lt)F7(T#zw~isWXy"`vxZxS^"ơrUI?<(}iG_M00iC0 c"+9Oʖl.O GJt?ʗ=3B5I!~aVd]8 _ endstream endobj 336 0 obj <> endobj 337 0 obj <> endobj 338 0 obj <> stream x}ۋu7r~ ݻ;$@<<93s!d0Tt-iNfvZU%.*j_~x_~n?/?|˟//v{W?|}_ 7)ٛ͝.˿})G+C<ԛw4δx1f{}z8шSܥ.{ ~/ۖG2n]G^%pž}KŴtwcjn*{vg0n7ĝ_W_si}7M9u7vW?~/l 5n:4}Xb㍲)o,ݝG È.-3ƃhFߵS4 {-A|=4ΎGO)Uآl-.ʢ?U+kcߝFWU 458J;7L]Gݝ2]2L%\ F/H{iT@&. `?Qkے;6qn2ЯL; 'Ab7aDŽ.˕J9?MZcFl0 kW =jW64+rvvۖn!]SM#r:C%vaI{Kpäg z͏ ;H1ޓhq4RɣHɄGRךXlݑt<4$[j E ͡jxvS=(2ny6!Y 6G,Mql;rݯn4ǝ9lUߙdoMNXۅrw)ƁmreϖjE۶$O6Jg2O~}]O'@ l8=dU63^(6 s ߐ(ωO;+"c#[EGEKlVL; Ra צ( N;(ۛ-ЄkXzGxE ;= a, طa'8@OQ c: 2)iL+(&XZ4J!4dKs2`&_<ޓMZl,n”3ȋƄUSM.zPO6;Ac&]7VWφPtWxl=^QRrq :ϥka| W|-g? ?7,b|֯F >ioߠ)L]0b bj{oͧa`S&:1 WvtjFq4[:JP[G{1'Q=w:.Ÿ\5syOY68~fP+|v&kp{=S4;:l2q%N?WWϨz؏pƆ5}wB̃1<LA?2EaFvgjG&3O(IS 25< &tؔ K@sf'X^"?<'"@ZV?uI=7W`P+G\}mk °*Vmm %ΪfǦk:~lgf5 *.aSSac4sHKcEm&5&2dD~ٗyF֮|g[qٱK՝߰c20SҁV}BtNWE.8DßX  RۚB?e&Cjj>pZVlLPdH]ϐڟq<͎[ϑGv]_$*+3"ݗLQ %MY}RiU_|QzTxBМD/7X}8n3`z2gC1S4"JPg+v[I89$guU~qAЁ_kM#LRes߶z'f@bT\6ΚT+*{ g})=S*w ßyW25,mm?e&jfC@ W\vL̛K&}vM\ '8sxZ5]s.WYc}Λ*4s'VQrGC n( W8}"ծOɣºdQ]}P{,賧Hۉ>ywS8(N)N&Suzd29xG6m "_`2;8,MR)ŌtJ@Kd甂aT$#)fŋ&w*EhIc\ņsUH@UhZɳet(c ?ݾïdž$@p{u}/k:B&cL3lȺPltZϖX5NQ ]]QW;/(F PXK's` WG'N9g BǚFx&pUC@OMlN\MT[i/M9H$ 3 W`va.y}~Lē&")LiT DFs5&"L$x 60`kF /?v=?hb?"Ҹ2 GqTj$7 7 ]0v! ./(8+! ) aptGWފr"k@ @6d 'SU+QpW)e<2gZI+H}D`pQH=0a<}~fɆ[_BQ#*𢱱O/~r'Rkǚ-4Ћ|H&,/dnj:1a eL#ZTR葝tjlšG!JamsG KOiCQܪȈJU 2":+ylYe5c}fMtLYǚM֐k{2)_qeJ]fNbgݪbݽM-Σ>g849J(aGbU>Ma୲4,n /nMR`yyAoWN ߳,CR13Sicm9j6E^S`p T9VUerƖs63,;=λw&u%)!՝[xPh)b(лA@hX8ISHr SHz(!ɣw 9vVI2I)mgsV o/$R$%IqnFuxu09N6cEWw!WFw!-sƄ3_r~{r]^=" 됰Dwg5Q= S/^ul`琰zK>f.xzEM5𻀻 o}Fqk]PJ{Qr88yjyW:**miܸa-TWFUF?i.!$W/À2+˺wP⓭<*+4 6Utv`VY9g>딝mum^"47G+sVނѮ l]47EĻ$JW'PSj`nobu Bcbpx"f,%i% " UMZ$@0B0|hU$jβ*U>Y{fϡSxF"$ B6m 4׃]VWǛ/6&&(Øo?Kw${1ePˊQV tDl37C4:{EW?Pc Zs3za,*֒5Z3h:UϺ2VBmxr@6Uv`N6КepN>2:sZY//TZIngveleG8"%Z?Ϡ5/+ԠުŚ)q%EX`-,k'*[kȉe)$9=&~+|n|{U)+ADA}F$z앝} =k5fDnKSXV/`Z=Xޥ`{=r{Y=nV-1j_XD6"wь=&*:_VќA8zR9A ir4GOCۚ$i0dʧ7bzwr7PKEDYMnS P6 ˎ9E9BupK_n;#q] F,Y Rl0<&WgTŵA1̪է![sT c-}J]؀㱖>=u%NǷJ/KAS1Wǽ>K (X}c5Xɒ"SȂbkN"E@B FYd*Y(d*Qb)$>؉y<(bp9H?tA2$AQԠHT d! ) M w@ȑE,BI3K UKܾ5p?ءx[z$MSCp;m$sCs/},!OJxε?qcG>ic 샩7k@Q#ŢJ|;KU5#0lmـE!RI /JXo,T_)K%I'ciKd^L1hxqT]),$RIBvgKmRI[x+82h\*TR&\gf,<͝RIBpR0Y*i`J% %ՔJzΚX,;P3kRIXYX,J/nJe dޒDYlSTғOpN՝ӰjR]_+d7f$K5Ψ ߲V(;G3^,H,zl45V(SV*0؝/睮o-NL,^-IhuYH@سaד{_Sm+(Wn(i*4tT16/<+VݑS ΓOFk*- =}|>y$IZ$x*Vz][M%~H˛Ӆz {)r1X;3Ka4bGVTypƇ3D4k9;*Cd_|q3$Z!zsqGlH[mWTih铇tBFc:I$ D'؆|[DO>7=IlI%:PH*QHfH*Q-ԂUBRY%I!# #QȪ>AxRdSAD$ -D ^ζ#Ի$V ]kӋ/ D!*f2}p䙩궁 e-ux->wN.t@$bFWNT$aiRdH zӲ{X$Btj @Ju >}z~dttZL b!%Q@ąLE]^0XNXf`QV `Qs; `D\c`fϡSXD6$$Y"n.p= %aw>U"|wgfvT]ۀBIALC'B!?ZB P!XC!C1AN *PoH mPB$l@!P4B[~?VRPW7 X+<P. (T۟7 zʔc>Z>\Unb0DЮn\p,Jj5 cq1g+qc;\piiS*zuV帟t/*]ľl ?HpX?lY$ɇ:JTEZ?-X%dU"ϟqG9|f5n|eҹ"LN Aݕ+d"SQVTءŝ48\ b|0m\h810w^z%Uz7uȲDݼw/Jރ+-e/ifzS՘X4e9EY䬝ﯗuGdYmU 'qv HVKdszRZ:9ib)^^{YK,V~zոA\5b'k?^\#YPK㦷qqmݻo ϕYX|4<ƒs6 Gj9bXGIC`FXt@Ď+X- szUEJyQDIpXQ#haC2 :yVdUI:F|qUCӇR귋dKH trQX(+e-h笹#Z0S{61zV!E#kV;`šbbzbǾ!{*}FxdMcךe)m}7jeMr%1u 9ˊ0=̌WlFFuDΊhV*US(RBj- &WHpf!-h@fc):U CWe!ni-v2evQNt6JMq0jLb?-VmɞDu.T%Q/`XZx5bov x\@p_ڲfd6C1rOSnX!yvb7${؏hLf?L\,fΙ{ȆJlY`Y\ʸDžLjX`9;Jk??^Yv4Yk%tb ԄIB1mizuM 3n0Nۯo)`b-DҫC!˶G0I AuR\prŞ-a)SLR%ueɚO% CR5j.S0)Y/U]}ʣ[Ģ6*ёI2ǶZ-@1[pݾ x*K2Qa C|=@2._͙: HGt7LJAt$t*t-(g`.X `gc)ox*hcBr+.aJ9G 5a<(U5* >&;UEzyie\*6IݷʫJ%i(0E=4鰥[isJY;yXGafPg 㴘:ZMRx|y]P;qT;B5&WaYZ~Y3 eopnMZ1TQ>L HoCZhiy$i;-/ن bGEo|!bu/k쪁S~ NêQϦiy~ZհoCm|D6.L{6ȋ~]Yh2<8=)bR|\ WX(E+l<[ΕW@rg7H i--0nm=P5TOhW,eAM h_m$/,+>!کK`fڰKIG6rhת0h B \?X۷78=!9R vhء+R$c9Ԇԝp:ނkOmz1YY%&@iRݥk% 63~=/YJCKШN@`98wwWb9M1ǂ HJdUYo-('nlBmuԦ }]]xs s1V3C,pf-5!9zyqg:R-ucz*n,BOB`2Ǒ M֯WF[ GhioV=@-95\KB- yF2rxq2!cNwhu=qDx?H vtJí)Dg#~X)X^RO B< G,Z>nΉ}Ȇ/Q׹e*^H:ފwnkm|$<|2ra388Z,C ՉSEHןLs٪ڬijmd-Ҹ^ǁ } y4{:oS^3ܒ](c.@ ףT^3Os+^3̉&_wXQȦM`ΐנta~ 3 ?2@*F,۽YR+@ BHuk1aTxj)҃\ǐ.u=Q,nlDE`-piRahdF4'8DΜC||v9ȉD^4JMCr)ϏyU4 p(Ι84Uo˳-N}> stream x=[&m ^ ؁`\  A胑u!)H|x/?r/|߷>|?|/r{݇7z~ވ8Wwoڒ;g{w}$BRA%yeEK;'WJ${܊C/䉙w}r9֐Bݹ,}[ZE/G˲PM#OXUQ*ɓ~rInJՌ Ve-17i]N?_'ݴQ7a]??wۇ>/? 1cIZcGJF07ʱ >{H 8FNTߕH#\{6(pz DY2@#x|5mֈM 86 iXni'E$QTSeP砚?)H7{IRÙ)_+d)w_e-_j7%z]oZ'DӮ^5]IxZ( ]3äӂлnqc&pևΰPAa32^e 6Nޝ0|j HHHM=AurNAzڀ-aF0NQD DPa Q}9&as`y)@c)#gz'hQA*R'fW,9t9C=;Cx'K3MԮQB!Ƚ+wxg/ҕ{FWJ!Mp~Sk<=0%/¼bMc~(#gi\іWё/*]}OU>@Es>;UsAVɦn%vɻu0RD[t+ًB!#luA7_˾M+zv :_&=u6<w϶t+%jM̎&r)rƋ۲/zw(94zA83^wj>z!fxt%~#Z࠽MIPC?e ~`:~6ԁ&SW2*<!1# 4:ei:\}[Ƌ-]-^9[ -8 rja7f?¸DuSǸ^-ԅkFt?]m@LmA?A":mWt$ŝ„- /|-:$ fߟc#D_2\9& ˶V+>9`ʪaLvlZ tE2amV3\ ,vMq2[.U̋7D̠C bT9X[G^1\`f$ K``d|p;C@ܷk!.j"^ߢ[kqxA``j G#,@D4zS!;~ ͋c8!#'yqŒ&?-N@)EwEQ3ASS&r)1/N@p@qBā'`HbqB8!'yq'DHqG Hf %#ʃ];hyciϱX@4QP4I8PT!S1D1lD 4ʊ%iR)Mұzl_0_W,4Nˉ+*%n$^^B7jWJS\;j9w&eV0<:RKy%PB-'JDߎo@be~uL_IYVGJ9=,- *8lTJ NNA֙a$.!sg\Ŷ~m<ʝq}|Y8<@ԓ+Be]aY@(A*#=}Q jHL_ I8"@ԛnQAaoPf2fjJb bH‹ *8tE‘?aLt%{s kTip^ۡР3$=N \1X&ub2*$pXDƊ W gC.1w3"|ҽX>LeP0Xu<9W1w<}Ev mԃڨ1eQϊĠ3Q<( YT(8U[^{Ķwz*s}1gH 7S@,)QE5iGr>*VE-&׹yy|MQU3 ܶx<ĴnTxyGZsAy)ykm0:c{a* =AJxQIV29@afw(ו7]S.N쫔R63fRxwy|?iUAPsG6؍ J{ ұEǪX{:례`.tԣ\1V9$bjbzjAֺ|Du>"|5X8ܢ]_Z]xR;qCW` ? c 5)YnҲ4Ѩ,WWj,qʴn <2i@ x(:Ӻ 2Qk\ 9;e"{ DH$ dNy@ l@@D `|Q@\|71+nZ%:: :":Aa dnqM{5;A5Fw]y읒~mih_;X#^Tz OcOLUY|j~ 773? &H+@\o^54XG! ;V`u+#)R_;El睸X ۥZsM G{ O[~}y ی~:ߊon16e %<v:C @apC0|[0Oa(B- rlK1M!,L[D0Oa<@:J&Y̎ xƟŒ{ҊtE2?rta)`@`iNGR` sB\H2"tkS,@( H:0αXۛ"AVNH0BLhf2̴X` 2!b盾7*oIg]f^˞ˢbX疨#3 WCyHyW_uHȓt8 r>8_(gF%cDȗ14b^\qPKⰨ89>e`G&⃱L(;.>!tdx\9EI7焋ԯ^ָDҥJ+a(R߬tŌdHcf%_2@wQRq nP[v\ڱ xuqT$;TktYA20m *9ޮdbJݨ1cx]O+\[O%0ꞓƗDLB S³5+K~v:2d$k ďI~~r4r5,y}~x˹#dC2]}fy*:yhT~wH1"|~^MI0;dboS;Ge55%}:ʓKߢ=6sp3{V˒i/#9bo*M%9vL@0#@!@E@CuJxF~Kʉ3b=9/y9,0K. B|0+U^vR)Nx0$0p F`)Z ^gwOcCX"6F ηe|ykG[n`1o$c^e4'aOH݂'~zY~d/NShoݤ َ9h< Q{Y-^7Fz/]B$[ڮbHψz]?IZ_8S]S]QK q]1upRWz7C~QWKN&銮PDIWhSwu qIIՔtBJ}R~ގ?|%[Xyix/?I#Thԛ'R_}&9aX 1K0,VО?1"»y"İWo'' {1ӳ8g!#'Jds(K'm='3TI-3|{<>y\Nrlp M5&9d9`DVU@E28T4K%T'W="du6Jʵo+?I}},w!;#M!s$4}Wb}}I=C6QPI _AY$(RAi\E/,~*beQxrM OZ3B2{/~49DKG4|,\mb!lJI!\RGͤHJP 4HF(B2BGd c)(K1BȨaK4g234>Jqă!c003(`!0$J7&!MEkg\iy⒘7N͛U m/r&I?x|Scdϐמګ972D [t'*$.׭Sg9}JTnybo N`~g .jk<;-i~&:Sk^Jv5T郈N4~lFrA1#?c\M]ɭƳs19/unvţ^xkKSAbB3 M0/,nx ☊Hb>g )Nx0$0p F`vY|B? n?ktRA񯪯mɢ>_gOf8ៈq6i5JdQ[F̌l| :{\΃kH|UŦ9Ps q/-σ mi!Ūgk`/yσ5Oq!'E2DiBËҷMh8 )`X?O^jQòv.[s&UsIEx1w9xVAb 0S9KEPcj-0q|pE nQLv6 9n]hU+"q%j %-.Hr wJpD (Ywk}}n)#׎N4VWzpb&o]Yo٥=quݎ S6@W,6E$X~6+<ù+J4hnAZYQ*mn VdFി\ L󽾄;~x#\94DWVYVr(OFʡ}F+~AeoQ{6箿cKQ/5B}/5BR1RT\$%p"y_S%o PR2@N౰S ` @,F Q#l)aatlX56N" V؈AP0!P_`. 619o»DHEWX\gA W09fWfxq<{}G.Cŭq^Rؿ?3m l*c÷yNnk^sPDo,fRH>]+Bi7^>5u֌׌~͔sXUq.-ړ˖ae6?ps\.|fBa0pXEZϛ`h~/qu ,|ԕY)Sk@Cfh;L+P#ŏrk\R TCzrL>yi)!'[*ZKH)C-NkLq3wZ95USiBy\ \a*En4D;SNr*\$I d˓wɇ~y*bƸ?+NDo1OhVZ f]O>+qT^\~pTJcLL4b9&h c#8( M0;7sO}:$! `TU܊4T};NK+'+I2莑ezN&>-'Ad"E3i);G']9".@i':䶬77@Å ,j#Llj6ߺ9@=YM$4u5:bi]%!:}ϫ&')<̧1zVu ژ:=sZΓٗG!Q/;f0ބyTn,e yNx' 8 @ЀAjg E|8^(D \Dn36ġ9ҏ@t"P̴z;FG^MqSK~n(ZF=0kUj{#S?--N 9 |3X}X'_+'3 Nص66KpkA5ٶYjKzg_u≕X241bps:< XȮ C] ᨒׂ*97j~0q9wDf ?w>ĜU4w Jpg K@(=uzM\\@ V*^ʂ|swT,ٱOW)xK,,,^XyHRUUcaaIDըlbaa|)#8S4fX%cJJ5VI2?-O endstream endobj 340 0 obj <> stream x][7r~p^H ̙ kDA}0녀 >d7w=`S]Udo_~/>|?ß_o~t{??}Ooq7FM[qv׷og~G" *ɝœϜGHvwnœ!D'̧>g'*qB\ܗwyQQ,ڴ)x|ASqW%yN1CT1ͦT-Sw'ߒXEI+7nF|?p5tinˆȦwoܞt00o_W̆QcfƒnZ]c'u/V,>ڿۺ+xgڟ~#A$lR=6%nZƿ;8{w'$2K|E o9Jo\ !ڳ5$/]>ѻxN!>q'J?;yF(!== r/KE"/\S"~36&ƣ6cT7R^B"TBFl)C`y-s 7VXh kh7enF>Qq4 _Rj゠kT RGu7;MlZ\e%7JKQ'z^r$}q΅&t"(*3F3P,,UR;3pbxl2nI IqaFS~.xZ+\4Z|w<\54:| sGwΧe{I59h8v_*KNޕfc)K_컾H :>l`~Z(_ofvbf7}1W]>#ilj+r멲dG\ҡ$盛O^f2>9J]"wG\:oGby*ƥkfPt>79M?є_} $`T2dnT[9ixKbiu]'~hk,}g:M vHvf~ BBdw" ;e8$Sb y!2'‡kŷE$%HUlو$nj/ b'Md29r* V1dl9Qd#m B%9hXw܎ )q YDAOV p̺J#+BΜΊтM5Oٶjh{ヾz+~s}, ثy l-hWK'l99b83g0̜(sF&x0=6dHz&UFԈ`uj$s +~A3NJy1|(&͊ ")Jx.H#w;6yNX#XJʎ#@lc|4RciLnj8.12R &sϋ}D2j+47$UnbltlFJ',YdV#7Ś.}:k8o &?za#u]c_0h!ݗb6ʈEs%ȋIN9ƚҜa!3EV1AV8ԍ#@G)(LqLeH CG?\R9 %Ii\%_f,@GiNjQAFer[%H0Q)P̏B&;б8~K E~l; N̢j ' bf8bY1Z0(393&w\ȑmDZNL|m}x][%3&MJdQcAC!;FCԘqƌ5&&zxg"DkEP<'4sԨlw+Q2a"ф&ō-'~q5=KDo`eiV%őU $'4 ͫ-7Z)ˇu&@$Gӡ '/˶uu]C_1|gcd`^]e35mjY2ȃuP_DZh^I1Ao. }IEm@f2~PBL˦X<%,KbV͢)%W M Ȑcb44%JL-Tw5 󝢴dPbZf`NxY]05S6s89ID@>hL|̙X!3B2‰`9# DWiSXEV(Y %%ț˕%JJʣX4q d$ :2f-yitQẔUBʨtRVt+J" 似;)m<&Ai[4>aH׬+494^1Y1Z*I.eߺqcWEٙ񺮐#ٶ9 ͑$G"l G4G&>XLYsdr ( +r%be Z Eu!G—K"YyH?,I .Yd Ul$/.&9 H ʨl0YdClx# :_ OlpԦJ#KBœЊъm0Og*.ʁUij^$-oo.:%K9sagk7blBΌ|Mdkj5oz >ƕcP8 qeY•]~pm(y3-`x.$0r [L.͛Jy#y# uR:o֒G#, cݏ~(ΡVݴacpU`R3p̱h%BV:ё0Ott[L=%჻$e`/ϟ.q4]M:ʥ.ZZ-QTN0>#V6LEPp*[ҽE'C x? IY‚v(eScD8OuAX搴՚{BRnT@0NZsxLcUp&Du+*CI\豴Mj뛺O&庂 jES5k*c"(_Ex 9c*/PyI|x[ aGUU sVRĪ!R{YD/VL[p̽$ ;&!+PA?G+d2ΉD7737 ˬk>9?4i`\PȘM2L. a;*GOGb ".q^Qy4kj-ģ|ʩjuR~:NԵ0z2Dz@hR8ᱦ*Fbʚ%^=(Eɾ7熿g7M\)^q=.[r^D *9E"1P0HBUyDw[Rq\mSyiMmۅv!]VȪT1 @0rT ]$|?]BMTUn:<<=%SW5T}XױwĊX۩]^DS2zӅ(MF/%>DP$,=:tٺt&N \7ܜHB18xLl?M}SZV@UՖaaBbː8Lm]Z/R -d,B\e۩ -k&;,x ѝ* \ TU"`UT X *NPUIC*9Q((vPU[l;bL:9UMEPt Zӈ[Qy}3OPrJ"~ %& R6qHy'j 9ph󊱹7sx!/R'LųP=J@ʇMh}goyRrGZUeď&;Xİ=ۑ>/5q^]Lfmfԅ+>5L̈́P3Z Z=9EfQ30Hj&9z~.qaLpft(07K#1ρuNM/+j&Fj©hQɽjBmt)_&0^N&\rxp0 q Մ1p.! &/j PIo}ju"؂ޘ sMĄc>#Tcdӻ Q1"VKb).jH" EuxZ'Z"XXu]CfƿS G'gV st '=]y})\wKρ`ts@b;JXy'|(Xy4;@nfˍ \f3/VڸᓞLNqU*8-؈dgF,1UzʐŖ| RjRheĨΌZ2C0n~̦U!lO!]Tȴy<3r{ּhc[b͡ JNM\Y& hu&EbuS\;Dm8MHQ"šwyO8#+w&Bv_<*Dz.KOW(´?рxnHP#V-|dq}vdo#@"4K@h8 |BK|-c 4\1t~eFmS@hY`5BhC fUNN@{s-t Z, z2 4 1:r9|%5HT,Фʹ?h_?%F̝Rgʙ'uZZ*"F63bgɎZ9CklIݨ<Ԗ:9C8kT:"bЀf-S+ɞ*{!RLp5JSUe:fj%phB@gS|VWTgoyx:knTgBt Luֻ kS {J>Gpg"aktf{}/Bf tg nYL%qx6$zZtmMwЖ?k}.  !\l"&x ,Q g:9Eilj3&lgH5ӽ~tLCX(@r/M;tٜXtyPsN 9Q6Dg朑2Ll9'Q6k"3T39q`ΙZ9sV9gκYba ;~K ~ ~3 Ƃc%ALNHi¦\Yκe w3qamm[p'ǫDžzi(xm/M:JnL!7ߜJaKO)Ϋ_q\Nrb>#W-=YYA uY%ZƼ,v؈3k3%t81\q0{ȁ3ie1xUx94JSϡx}-?St֛9(B 2SK2+Vrq|O7$9$+?]꟰^eIض}Kt09`YF&~x/e.ߧ/spWDޝ"֯;TK^'j!dW5SBWER9G,onLد >iͬж${ ~oMb}ٚ>Q IZ,YS7Z %*3/lMalKsL8پ;/g%;;EZ]9? ނ 1@GHC9 EAJ$9SiFJNrqKw  &nj/ r endstream endobj 341 0 obj <> stream x][q~_@aw 8gF'H6  ?,c >nUd,!FTWU",?_n>?߿oӟ?_|^?ۧ?&3{ݥ}˻oO?>0\q͞V?K&_yrœ?Wǘ"ܯ:̉ƜR.uiowߛow[ku.+cU:>p/s4=5{/cکcZ1c• 1ݙ7)qg}t9O뻸Ygnʩ=DOݻonG|//cǚ߭RǛ%fn÷7Ql^zh|~Epk1ߝq&dG\aIŝ+B`WQk ^"9`:=f꺌O-mbk\ܕI%QO/v^}|ClmtV‰#JSQ${n=a&VY=ڸ5?Rn㟾ߚo&MmٟBê1W0V Grnh%7= Q`Ԁ76j,*@gQd&5:Emlz[ڻ_1-,7t;l8iWZ %}S˙!?@YVh707GG3a9n! r,+=5 ?)3_r|+] k/N4(iYO6GY0f_$)4g\VVEO`E7=P^ 4Ỡ`pFuqt8${j`"R`K7) E~Z@( eO 9"l߀bF $ZX}ת&b uI$&tF%}jӲ7>aڜeN͎h,]$SSjMZjћ{jHXmil]8afNd}BOClu_c䯀lxcQlz9=ylxaWȞ.'ѥba.5 [g3ltCdsئ;ܐ ^w a0Y@8v} =YܐjF07 ;̾Zzlxh,f\YWgz@z:KZKq E[?izԚ3k>{&9l[+pKn!pV{LZLAYBlf;PЩCm*~t,o%E#Z9m̏Fl4T@IF-)  Ą՟M5n{=df W7>o%iƛ;/-Wɹs՚9?F|5ҿ958nɚVaNW6#7t|YŭocB2&aWNSdرG{'7Ĝo]nQ"'v=1}Em ::f=k:?o=+6fEͪ1<"UiSj/kJ2j:JY 릣ח_ԜD)-d5>z1圐.f*zi9lIXh:@A)5~ҸҲrNPw9&-Wp{M$<=l`o3opʣ1L3ŀ_U|MH[Δ85?A/N> Q]J\뛾=lo'o G b3 q3gc " Ə>0~܁\r7&z2w'T()wc^,qG2~B 0~4fhi@M){D$t'Exf+Ǜ.ZH eh ~D|JHK|US$f.6_S?fs.NҒփN.V0)xj#(.{2Mllfu:NڕV*Vm? !dL,\2=ܾ:E,rT&\`Ef35]Cɱ8Z +OXOu/XmxɦbO`,5 )Y>#Y^VW5: }YskfQ }L05.Ԉ^$s*T΄ig Z*b)(bڧȱzrOWU>BUdd ^H@UTJ8-c ; 5*SrI2ʤPe!sVeiя;tyu:Q}j_5LJW 9}3e߆Ne}$ju^S'SYW@\[G4q>?+E+٬eOtݺ/h^)Nq9dWUmx`2jxKۺ_4I``T$L])5no_m_7Uf ]O oN=_(wv̹b<xz2ɚq k/AlQ{}Gĕ`?9$ dNu܏DӋ`;Ј&́҈w; Hg" AtjȝwT\O8Vf7p2rڊBY85K.)5-{a;SO5+BZUHh՚eBp_Y`wt >0 M̄Շ|Қ甇bȪKHF(mA`V ꕙ=]_Nxk3 a"DqZg9rs^*XY3p T9 GU$ e?)cKGǀuWϙX8;N85UCױ8Z cO%gOueْ:Pa4 Os4=8װS{R8Cø}+raF3ń1 gF?0@]gI „ q?sK/2Ƅ %ш&́ֈu\ (I_'ebP!|P"ZFSû!LF^z<ƆˊəQ s߀ /^ƽ>HKki0 [da3*=,UAF[:"mlچcՃ%p_@XH`@3 /{ ߉}^J$3Yy ah a:ƧyqF+%f+D]aMmV WF)WҪǯ8JCn;:T՚Ø 닫)mqD TR N0}skvW}~6EkH Ժ:2}J"M; Ks4޳v ;kBZۖfts-ir[ T_;KeEܲrnʑKPq'(Q=kU+*MMOuɲ^ϓHTʓvҹR]p>_5^N"fhF:MZ Nd|7m{@N P 7AyxhDf<5|8@"(Yee]fR&Ƅ5H}[t8NQr2+TWu5ivWΤS9ae!`֚7v:TXrcy J|$K'ږq>hk;޼ wD8֘gh˞G..A d5>c #W{/^NXb14,(ǟt盄A$x]>m-Ndi)t?X(9s YX)ZI>/r 5ҚakжKVݠu*3JacG>| 5qt.lקF&-j_[O^L.LauOcF`S㐮ql't 5)RY츱-{/eI/\@%(Q hjH-;;I\ P7eU hE)>%^^ m*f2މ$w4Yӯ*/fj89| /̋wLlٌEbCQ+G$_'l"Zhɔ<4aV!B؂VN@!NL ka rj+D "kR} &ZݖK?؋p؋6)2/W %8{g΄+P;G`J097z5r˵ҒWyhSF mrPA^xvRV:MӳN*h^/\I1WAwۿǫ`+!Ho%L|AѠ) mh-J3 6^rWONq-5%w\>FYf$ rq2 LAN@-ȕ Z I[6ܬX1\F6ہHMM6K=7f  ~8.ZM1m4LT?xDHHj6͗Ak~O+7+J\w DZ\4L ]Kx|sbw-Yjw GW8΁J9 5(e_bDV.jT;RxD,7W>&N-J} ~qF I`pBqH=[c=UKs&ItdբJ|$wiȼb6*,c9eg=Q?#zZgoFߗkQ`8C֓6qy~@ph~᜴;a~ԍ4azh| >.i"~v\5 ,r#q[6A>PYi>{n(zhr hN; RyE9meIImG5%EmX`ƶlJĂPvYo7Q8ҧVVMTS;@D ,IeC>#)al hga0k˨@x|-d \Z<6KV|c(zȰ^YL }ҕL`>˖8qxaiz4J2(«8.hCh'ϤI__%les4- go˸.;l=- Yj=cR6V&K_FZkv₞lw%F׮\MN}'rqdX~2KZ9frQ3.\P{5Qk*_uݟIA _[_ ܏P\?$ՠ'2I--#)SZTᴌVOiYe*X]pr4LbWiil%e ,AVrڿ ha06\mQheհ)'m#gSMKh&_FM]ܕu,|WkN-7('TL}ZK9(]4FM)-_9I`v"EjڌJv=70t,ljEZ0iyݮŭ9E 4TjU+ΈWŝ.2k;FIĴzVvn s:(m5[UdFfWkeιFSguPΌe3Jg!l{b2ּ5:tHL4j"j#MÑWJά (GT ^퇍: Ή*pT B@bķU\ 7Zqa~#ebXH[mpgqS%J&wH Qn{z;pz nb$sքqH>4#u`dsk]i+0\߀#-\/r?^ܺ1vf"(ʕ\u~\VI]!w"W཮ůّã$hZS#lh#jw-xͶ\ l˕n֚_3wq܉#\7wHA/9<M3Tlfd f u- ľ٤;!ߥ[ހ#?C=ˮֳ=Y`%h6J9he$vj(6Ult(QڧĔҫl gUN|-3} T Cbp?n(lo |!hPڷfQlM9Û2i- ֠o=vnVJ"$Dڃ̡Z d$DsMjЋ6E*q;G``~wwҥ@x p+nSE7xݐVj敁jpOSB(0]"SKMrʳub+T9sQ?XL=զW\XoN[466 gam#nC5&5'_|̋lZ`b67ozobv U0&p'4z-/REF-"b`i|AlC6"ja*RKH˙{:v' nʗ*f)6,X(Cߏ\w(-q9tc T[&xtlT-!l14eu*W7e[[ 2w"|;M>ب{LarO~P6Lz|``yk_{Yʎ̪,pJ` q x,1 LQ<R7 eQQr@BiHATSxSj_t1mjVj>nRWǕ[yhK3K(]A=Y+J}f ckFNO+̆ޥOKߧwuNo3(6/㩪Ӏ%M3bx;F zn9vS}DD-l_wٷTU^xSya1:o=rE{wЋ+7j!ޤw"bExz|tv-*fсÑ$rL)ގBm15X ci `T|3jdD͓RHX*]v,U,8Tv,U[X:iKQV8K3vZ%v}F؉Y>}ѳNUq0oFQ I躧9(Z:(z ji9viS>*-|_.}{Q/|{Qi&@s"Cb2j`=PhVEI1qOt Y`T{{xdVjoU*)LhX&))*PQh%}Yre>XtCxu>aTۓn5hZ¹fE.fܟ3\lьC Wl.vVg]9Nɨ,N \:%> Czi66FAqi9v0v'jU}mWj3&.A_9갓jG] H1 J` Z`d=4)b8[퉛X[ 8ACQ6 44,P]֧"h(.P @CM}wEzr ,5~z{e㡯Ƅo鞩e'ݪΙLK/ǁ}wXQ n@m>v?,u4tve w#נ"y6V6yj H뱋 99󺯀5/pPB YA*&U8qPL9a@F@&CTx C=c2`0C w}YBJ endstream endobj 342 0 obj <> stream x}]%7ns@w0.}^dfȅ1뙝x⁁`J%T>,ERPR}x^~?ߟ????_w=>>_x|篿O<ږ>.J>ZU¬OԯWX|:뾮x]_ݿ?_ɉ d!NmQ&;޾_%Rem3 þ 4}qG;T̨}ٶ\G/&߬zl?a-*?YCz9bɟWOqǿ!i,IZݾV,^3{|"}SLJ?>+_] ]cX5ı^Q Xɸ}EB @Gs۲Q Έlu/j)cCuQkEyQ/VDOή<7/SReˡʞ{(7F~|uRUoif"[ͨY+f43N1J.k@G̨ݿmɌ̸xY3ڴSlA>VW-쇐 @ UyD"tN Ua]EMr]r?}{Lp[gk,!_ ٕ4%QDQt.%)]oDA=oԅ1#MCREm%0˨Xpf79 R.L{78՜72S^ŠәxU׏._֏擳PϏOwB%Z3^lKsmǹ 뼔|hhEnF43[uAlɌ^Q~"f~um߷뱛*jco25z~XnZi8N?WWiWI~nYLYlrN9rLz+^-yAaӺ^-9Ym_:9ǩri#]O/+>#ԙ%ĄSK˛r"V\!@o[v(Zti)Ivv7-|'OY<xPn*1HL2pSO"%cѐ n5.ⓛ~ܒv9G{CR¨S~ܫEfR.[܊( 4>Pβ$>hVDYhW)\uTN VaYѢiƊ߾K 7jB4r룜i1e߄̲7xsFnqV^In0JYb7H7ld6{*!'ǮjL Cm(z1Vbf*Ls~21gdByQ6# gʃyݶWmFڮkSNY_p1u090c43wRz@8L֏S;nt@ֻsFPGJQb1r+v1ȜbY轷N-֗!vTaʃt+#Qof8|6fk~ 48,aIs7CaF[2H &m=tK IF:K>S"Oz*؜r4h2mB4X@[S kc 'fTl*)1 !ɂz(oκ9.V/b==mvT03:M%6ERw uУ99ZokU~&z&Ӟ[$a' փZ+;d^39qu:'_zl_|/2{G"Q0!7[r [ny-/NE ??7׆^2\>¾{ 6mjHװüq]:L9 |+:?η*9Ѵ[M[ 9zN}8Ĵr0`s>`59ONvo^rV}Gnm5qAgdnz/1:3F #VE:+6$m]lag^*#hsϻocAaD I*>"O ĥ %XSc* <'MDTjBV&.17q!2M>8!J*#x`blҀY"LGyW-šsr9"La xp MBLa0ENl:O< Aq4ho t]VզĮR d{ZpFyPWã/EOgق )ו^\)0W{V_̗U aT嬒58YX2/oy_wU *0h{:釥1v(nY*u:=z}ߔ.tmM+ ~o]]ob=0̥)k<=8'6$~淫>F^_l *Z?}/W:=Ee7( 9-*k>ڗ4OQj+:#n9Nb;αSTT=k#'wX.h a:sN5`^,m) ݂YN.?pDØkj,J+ny\7p>0 , Yga B|8K,BT޳g T<2j,<+Ug!F bQ7I>E ?R"tOvfЂ,ZnIë߹fbONmZXŢk&/lZ_TWJsѴ@簈.g4уtb xt +#S[xFe, fZi=w8T#Y ,=uztFl ɨ/vM~\0l~F.eaՂ *u1;!4pkȘ⊨KPpwWD7ػ`+8-THM >zQr]s{ғS[x"ӣוO\ȑX+D]NRVطFV_ve=kh*K@+ڌ(z|&> .^.PVTXJ:؁J&~yNTbgDIȰJpXDFXbBs84$wDXW'C0 B+(! %Ab H}+cN\BÈXT|" '-/N\BÈKp3$]xWSTۯf0ӼJQ+p#v"jm]^le½xmy;9o_3\V&=3olqwwNG_\UX -^r+&U"[ILuOlRp'\ӓmJ1 uW/GAFԒ22K6]<< fKOd%:t#cBb= ;7E"&|\ 4_jλqs]\Q29'x}PCe8,b!+}}!gQN*9)~̚%=},rU p id2O~FpU^Z)F7,vv*Xuf`HL !{lj5u1qcu*X8~Y1\?1]!:{(]l<&/<b4?iN3Yo*YU FjPh@]|H85M>32Ρ)3=,;3 aʖᴳ]VU8uXVY為8*ub81{5 ]J:b00lY'f`:2+S?m7"h[ͺ)#_=J#>nvM1CtMohsֲ0V+9eŻypUѺ7ڏbMoZ۶ydˍ߶Gv`ε(#$,?kyVAC/OZ(8N7xom_0.+sroR+@16ɺT+ȇÁ?eV);?-O*$t|"[!Ќ|"fgtH3 2AG;s~v5:I6fLoa^ޙ^$s~. s9~)vJ6Hݑ\v;r$7In݈y픕7Qۇtqry!#ǾhGOCas. ɑȬ~gg!!۔pG5sQ bMG^|z~998?P6iVʺ_]+~b/ʧDN-X#ksَWbs|/BҍDbO ݳ!#{X+OHyܣcR)uubO/Q+1EP}7-n3GhHZ]tdzuGgמR) }H us5wUL+Ճ?91e->]C. ^ٝB~mZ|=M/QekU6 Ij5[c Pc8g􊢷W3.|큕Czj>5P!z-[e/*LUښ ;"}HeܸhGÛa,U-|+y|ZJXЗW3/+iX`)t9]"C%{.X1Ɠ}~p 'P8-i\:rl"(`f+i|y9In{ɯl@J CQR3ė;\W T$VʏʔhgS-n{ } >X:40 &6,B*n̢ZV.q4_["!'$w:ӫFiv./z;f'`sW$~1\ZWail )|Sp"ԼV2D#I)cS'OeP.cYª=0n1Sidw 0h#/+p2@`9 K^d?YK~/ltAOJ=GJbH;p@l ldn:oŰnb{]grvyslR:,ա_YCk.Bg+ B $DƻX ߤX#+ kLJZ xfH2±x$XݧWWr PM4!q|i8W"n!nw:vKG"]MȆ *-$H!p)b:`np3y8M+ y Mv3՚C˜PȪ1)mNNϿ^M*` '9C%H1)E{/KbV;Qs `s>³5hPYA{ FQ43?*f.KTUaq2p{,Q+5*?oYx{-Pf opQ7lʓ]*Kn [#8E6- -Ti o &#F#Q}J7e̼Rp&20V(1qwq2kWdҭ[1G|LZmB>SʝY3=!~ܷ~`0!oۈR&)kFr 3eY:%qos ݹkxa34WHЌf~+yD÷1avyf//$3I(::Єf^Xfks?Tĸ;}p5xG̯ tf~즱] @86 5'APqw. f%{ss!Bs N&n`Dh& 1sI4. Г}=j_3J4rB̜3<'q#bRƪ0N0D A})u D,b1 ^ ʂiyKVौMysk#g_I)dI(٣ tY{vLk6lq#$^ _o0~|߂AlnuuTa_?Oe1wE#쩹6Cg+qLxcxP>}&^'"GiT4p$x PejP y{z}eV*``܈jN (6QȊX|ntJĝ'(ȟn`օ׮Btʼ9x߷ ٬m>#X7qqGoe7-|&5"D?sVSY@c`/>%O%{oL`A! B[lCx4ޗ BxKAX_r<Mx{\N <T,3MrfrqI?oiB>[vBqlp$w.L 9q](VGP *D?rP?r.TԉB ^60JQ](PԒ9=9# t0_(+#N}+@3o}Ktt _LX"+B*ͣEZ}hXiLgH đ~5vFrvkӝ"˗+$D}"FMLAFƟIgdcOg>3.vo򶧻Ҡwv)ӫ&$:g,OM h,w-k[_-+Ͼ;!-ey:'0_7 AײТ`\K9MJ۳,rҳS^vp IvM٧c/jVMi85/~/[$Е|]ХGgx~<|]1uiܧ_"7n}ƑYfmoa$Uח]}VK1Ƈ;YA쌫;7֨IӸ< =>|p.dtģ3w2dIZKwq9Ke |(s ڱKzacvB]6:dFaEC FCC=.h L0D9&~DsZ%bi j8Y, xGrR6 id=:-M'I:Z]keehj)$=O"a>)ƭ2 M4?ٻI8v{wvg_Fc{7~~v< V~29>8_I(+0'l>* KAmW}|^?w:{ 1]yKZ|hnih† ?Mu ]&Fcoţ&vjS}Xh%ݴa7 @ÀM?&~6R.Vi8l?> gx\wx6~$l\l}VipJ b!̀$-U11MNnt8n.~4t9 ٠t ɍ=af OkK ɍMOm|yq9JG9pmkv9 !:~`{΋Z{,d_ |^b"6>m}cMs sȉ\l"}: !)DHr>*bQQ/⡜"9a!iB-ѩg)qXlH"P0r1!9^*@%1qRHT(K;VHÿ %DiehH6XA`! / RK|7&Dޔ^+ ixiXA@,ب4zixAc_.5(Ȇ3Do endstream endobj 343 0 obj <> stream x][d9r~P/ŝ@Vfaa={yؙo]"t$)UfaOdD( I)_?ӗ/_?O?|?}?~/?|~O?| bI̓q"0\qnF?K&vL;Kn1n*w|͋ĉFRERO|cˣUYm؊9s }\b??bZ˶Պ=-01f%&~o7O?񴾈'c'e=I$ͷo^yЁϿ|_> 4b{Il{?|bGe[OT?ߟu[p/R^ĦrvQ;h "l 7.ٲԀFˋUOoחf_R/Dڋ._17Qa$N~AU㭯wSȕF:JJh/ʷ~חBۺStß*G5X[!es:Q.hI9$ 'E`RL]~JFʅuR4W ~s? E 7H㟋d<3߽ ^1~$YDoe+A萼}6.D a0~8ꂇq@hG#DbӐ0T$;$@aL i@~G-P)(Ic0~h0 ;E0GK6p K,6c0rWA4lVhsjC;TT93~(֊?^4ݍ6Q=-=lIfWk6aц:\_INwEwژ .%R].s2&C,*!!k?c)3+!lAanxC |]=kk|tpvYq[<AHwac/t c>!#}2GPk}C!6][.lj(q(Ư8 i(fSPb̹PP,LWVfn5` NЂM.{<(0' ~-Wd0Y(U2/܊Eɱ,F7H&yKW4}TjwTƏjh.i-aUP\\1AznudUI[{d]V_"-M}$&ǯCtd01y2 }1ɋ݊܇LE<4'~tґV׹v袋ߒ!+vߧqa2k`Z_ݪn~?i2]^\85Ҷ"ȭ/>b c[|+ ~ څ_0F{ {c)0FFhː"{7#c%2P3䀨s@{Z::cC$w M1: NQӀ45HY4M^&OꡊjH 3iϽ9@.{ wcpA9}Q5nPIp%̋xt8{wA߳J3~/MAД $i֌څI4͜TAgZK6.%.b,7v·k98QΨSO~԰񙊌CoH !tX%-HR^XH5>g\3Q}ޚqDeYhI ;@%"B# QfyM  h'Uao}B_MIef/"MP4yYS+2bEfQAP75!9Ffrؽ}^+r,8Vx G#-{hn1a4/`pBGGu@@/'&[VX4d6o~t,HO)` Tڌ~tbř=PqOsR pʸcLMYKIYe C:3Ob5$!=`{AA#Ȳ&1|4mH8 wE[Ñ1{FH fEhe/=B[nC’ΘG̞!2Ƒ)fdx(t)Igl3z҃e^:Qo3`oߢpQPWƣ pK_rrK'FgE[lshB@Jӳ0 -βv$?c2@* P SFOj*8-D) $'v} uJe idМz/"BX(.$# 1xA74ɯLcI&;MKM^F$!ec4iԗ>*6!öLk4g΀L!ZJD:tI1ӛ-v&5f.2%Pe&n;Sw3*2B{"u瑩6aZ"Yp{W|q8V7C|:'J[;z[ Kgj8/K5u@ĝ\8 C; <(A}nTߋ<JsEmгp5K; c?Wb}<gUD,-T6b{K#R1[Yz^>zC?`0Xua<3麣G9q>ZyȲkEtWylrVF ;aEeQ``Clayd^ASQN˻r$C78c1R܏C|vyc09B;L4TH 1:Nk}ɓlMI6胙(ݾWD<8 &.%u*nNb>jvkYr  >9]  㳝i'֑D#29Wkh$N eMWio˙:**%8i/G0f$z\j'|$7!MDHeeq\nF8 c@qrl r͎i@l7@t8T5敶D8>\JIK. ?t/yo<.#g,z_܃x9&,hLN=o;^.\/7Ovg4!1{lёEt'z+* =pY'׻bF81?5!%TԐ/ $wdIᤣc?yvN -qMw~V{Ҵc+cOC?ױ^scdL=5'4o 9ㄦ,Z\NaupBXDO,Nxx'8!4oMab:}o*'dkNߠ`і9~[wS {F2NB]BڏMnENMCK{(C/rKٝ}kd[{Ɲ JھCG>W"ƕMpޖ[ {Cs3؊hlP3Z1\CL-LW$׆5b޲Tt<}\?{EJd 1j&UA qa@ %zsu$X ¶\Wd׈_zX7Eb>0@x{ts!,^g+5hb[OU'HJǩN ׺TNZmJ>w }Luy{P.Qa8=4;3bh@DMl:qۑ β24V Ef>ج Z !J)-䄠_C#ek ֚A2yTFHNRp PA9RRJ!rWtRg” D190T# ʀrEq4c <'1lT& ((ժLC C* Yb64Tc6(i%:A2Ӑ`q~(i!8 Q4ኞJ cTe0QPWM Huu&~} &ZY{N&doSzmZ"q y }qg1]+ӷgfŕ=~7R^q%>hk]?+F m7VΔ|Vݾ?ߞo fzKy:f^_?^g%zB|]vOxnC"[187D2H 0goٝ-$#Laݦ7|0I\1Aq,td\-Ǩk`AKx*ׇlE6&NF߫Q/W'|ɘtr+}%\$E<T6E͝Ho ޮ>~$#}v/7[<~凾/2;? /ŝ:}^fPՎi0]\ Kp2$ h!Lp1T!ݩ+@Ϗ ^ZwlXܛ~.akGUW5ۈ<wa/Vgwbҡrg#-A|EyE?7ǰB88)iEy&%Ga}k:_߷C5櫪ػ*䏹\MtCjۊJ%R+B,1_W)MGKZ>M4{|_#-hjI~Gw"W~vy|Y]-0?lļ\TsFS ѥ'@z|ɹ,4_w3WƽbZ2\w^nc/+/ET.W[Z y r;dSu뙅,q¹Gl.$}{=ـ9z>پ]}C)s4Zg>d+DMWȒ8up$fL}~U',0 (>)Y-Cu붥*xWAڷH(w@ W3A0#i'vAl9AP:3?6QUqȴ Lk>zQR*,Y^X:SD"ZJ1qQU??:᧏߿s: I|O|Ki4M  2<^5u~kȦ#?(x ǫW|Q&wRmڰ8@RmrRm%jy@ {uW,;6.;[%rNx-Ҽ쥁3Џ+ }sPvC&{H?7veȠt}"w"k!R&nw]~b2c|[U\͕{OjxP-B=(~OQ,}dY &WёN!AVxIC,).Eᑾ#2s5d|цo2Lv0͖d S|؎Eߕ#V~cgZbʃfpˑ٩D1Nl ;g(.);E*S12;YS4#N:9hu"S4+NQ.,Dcb֨Jbq#H:& UJ[4Mq!mZ4`RVgTW8P&e)QGtPr7կMS70p#70 \t% & =yּb4٘W$1cL'-C$d~7n8%IvTs@Sabac=>  !((9KfAa,ҕ+ҐN}7cpJ)햤:bP򐈖#996U'Zn tƉteHs%ԒP/I+ #P +~+3soY潿;N~ ^̚"X'9KGsd FuZtTG)r6(j a]oHcBE&|wEPŜ:[} ' se.VxaeZ7l밧dzqVg}*KZIz,+mJd8Z|mIeqPf~:T20]#|sLހp7#ճso`$pkX,ɸдr0#noLmWZIGW ;"{,?\cGzey^Lk S/P?•4獴6TvUv9Rdv2th Q޳W *jK?n;6 b̴ܟ_"o4Ip:w9іi AyxbC_3 ];q$Fsi\l(g܅-ww6E[=Ŵ*:wR0ի+ ~ sNg = ٝeճn N!0u O> )?>}O$ .8Z@^_t~GQoR=__Cwp9 )~aLEpI(GOv"=ᶓDay@ZvJ+]L`iwwe _c D ~BSbÄe|@qsdR/M1ٰ̆7ʗ3 vkٯ+M)DŽ' h5>͇JE(? iYDN!_?L@ iztP* zpu"&f՝ih4P]-a_(R$ n 7Ew̅T  OТYgꉡ٣ .kzMgLp TZM*%_iVD^bWMViix/dxDUgdYV-NnܩMcx1PNVªk,p Fj!Q{Ǯޒ =wN!~\l?*,[>@׎KYKGʻE9EbrCBix\&*f2s9\6,XWJD6a^LKVHV\p$k\=>xq/ʯbٶW 1zRXA4ξ',[e\WGB½0ץ;2<ٹH3cY'x('c-?6ݭ^k+GU~%y(  ͨ1mQcsǚ;yۂ*!%Nc}>Œ2*tὲ}2ׯIep&2&wIi΅Y2l2uq8D<|?}'gy%;̷ыWeuֺ"{fQs(oAw+Ɏ ȾWqZ x~nR"ztj Pwɮ;N YZoWPq/,\m]_S Ge-3Jx0#*eY⺪KKc%I/+B}~n>8A%=r]-fέTʗ`DֺKJMZEc;1#=~Ru-FW^d(*X0]y䐛2:ۥ8o~oQ?}]=:oe(e eIۺ"S ~w+? _KP`Ɩ"4 tMDw6}%S~ثHDTX\:PZǧ`J5O2304@J4;6/yJNYV\)36Tpb1 {'9?MI~$*.^i `f "vAmk'D!i" Q Qr~B{N>ib6"u; 7!q7@Ƒ{J&e5Vu\N_&SY>;K]7rR3!3$wg5oK/ZED@D).\>G$ĥ(6+2[i,8^YƈBypgQ<݈Dryp`Mf;DJ) s44ʱ䔗|TaĤ9SN9i'h|bAmR)t{SPGE"8bw}<*OvlJn%Э j/dzJ1^ꆅWR5~אNXKݰ-ԕUn ' KN K _ ;i”jp/nެ< *T$9h2+]>8=FLœj\ߏϽ&аzEHEŚci-;Z'E66dx'aL.v)L]O\x}]{$>T '7ʨav?ݞt^, ^Y׺ٯR"MAuC}l9m\ yvS[(ųV㮉 v"V5%m|Ze/R~`d]/> y{gެV@sN"$OwRC7g~:v.>M~2 㸋C! qKI[?_l EN]q<ws{HcH04?wO{3pCe;~b0zs8gL_= B*͏~e!XY):{2к͟>eqEt})!cPr:ޛϷ:[n@7=1/˷67f_ٖKNĽYwSҝFaI(s8V35 1h 恺GHzl.03BmEgl#"uh% #`F0А4$v6$s" 9BrM8FjBr4'2' 5*@rNQBH+pH !9BrNCFcHbg)@A𝐂9DByB Pr II1z4("nq48-qlDd)(SB!! - b.Q8(ٸhi@3bqHiHCKí)DX d daVwac#,dYĕ ?}_ endstream endobj 344 0 obj <> stream x}]&7ns.}0pb;I.\x T"ORRc1/IQ,>%-ӗ?nׅaf?~Rßj|O WNoYcOx>mzOqI[zz7@oC-^kP$LC j~;$43;Ƿw/ݏmfh7wqkĖPqP:]:yͦɉpA2ì9a^_O0w=vh!Բ_rfV;|`o;sͅRK_%-QyghoA$?◖o[ă7T\>_3Bx B1~*W@!V+Ĵ(C1ҞJ:´wŒRG$g1x7~C/>ߘ"lo&l|CvM#e64;8Nz=Xܕ8fJՐp5*>Tm!Drއ.7/*?m8F[;AVo ~p'j QL#yO/">g_e؇u@*$6DgՊư=1fu IN-OckO\U'Y$M.IYtlPqlNYdgǁ߱?8cPsbW8!5 $fcs۝D_|vokt[ [[o渾Ͽ\-4LBc7iEnwҳ&wrή S>HgFA*37vI6 57vGسس!y>ONT9ޠڱett;f1]ܺυ-Ok,zZNXkicsM8;^,ƞ|zOZ2 YxTKPXg°)eQ%ꍞ؋Q3NdCIZ*K'9R=S&FfI>iU<`iY\K6\a"O`3?v>ɫ$"P)Pˍ2pvY$Bwe"7J& #ҠGDaBV"E^LF:$ ϻE'Y|#HÀvF: <s&ԉ=o&@qߒ@7 ݱ6F1u3Du޺ M,kN-P펹 f{;W@X[(㓀$dxhhOa-00aizL@Jү:~(kia~_AD[zAyt|¹6&K?쎄_Ԍ[gWh ;| u~mWl(^jlV`"g #F܊mB ~[d i HB\vc:0%h1~_c~O5sc`3!ba L#&& Cn00<#,&1/V'!A! !<Ճa=A ^Dt[?N~+IJ$"Ip/$xD!\S/Q̊$Z Eu0XƴmqxU3pY keDZDǀ# u|M~x(OXo j# !>BZp wI ~Jz vFL!mZ }$CWi;iX[RGz.ѹ" fQhYB́ߧQGU ŀh Ciטְa73Vb6ab8ʦ'$4`[[Y[uK+'3ڃTPTF$7:%flS6m >4ձ~Tt;= JW/2`Ks=tR)@iSVv%VQ“ć`d MBI@6nj7Oh&Kso&'-:ԁ ڔ@ٝF gb9|'A/kɆ'\3msO )n]nzGG*t%n`nuZT9/6nXYㆨCɠf2}E3B,fXt; 8nݼ93bh@fۤXe_n|l,i>6̮>iYw>kJp0Ĭa X!֢t!\f8"[è+4o~z9 DxTn/8MD!X6"g `xKNur Wj'؇)!K ttQR$VtW*".ىJSR^p$NuJpx"Wqcu?׈'$`;ZyH>-Ѡ4" 8D#HpE0DBjRķ塕>9[Bwh9ec's皅\'58wRtoʼ'P~o?l~)1`$bh͛5ꚨutm{宿A3!%ZSJ-B<*F{ϭ 01<.c3"Qk) n!㩺@s6+oAgV=Y7];=_kngNDYiQg,̘ IBG5vxK] 6 FnE{3#gR ?!uŔN9 "|d; o=P0&&"ԋG'@fϘTj+O)n9U]}P\BTo DvT;)?o&I%y䶀;͜q>g,N -N!NX|K-ٓa]uXLQ[aCr\(@-1!mi"րZܰ\Z uX*xݭ,%6lz9qe P+)n3^WF KYBPQ3WgM+~sdi.pxDd͸5 sh̚?Y 2O0É5++B Y`(dPǛ%Jlb7&!fg #'0Y!`H)ZK I ;b)Ts$NJJPSRA^$NJ:% CNh2y_ ^cK> @~*I$X zDi@L 5!Oz@9D3:;E=hQ'(Jn+ΗwXk'q}j5;w|\QBTR|FpU*e ܡ+CDaձomBYR\#: }襾Fp02+V\#~/M @05AW)GsJ5ze7ћ/Xp&MO`l9ϯ/"|YkӛK-d`x [P?,|[[-&U (̌P ,)Ⱥb$7{XǿȠ㽅[7bzy@?}w=E(>Yxs9 q޴/cX)ҍ:;W+دR>_*WVT|U}RYP=R ፋAU H69.i|͈q1q6҇z[v8}5Н#qA[_\8zFĐ W>l$Em@ 3? _Pb"n5n~"m0=F&7EG}nqYǤ[S@M,~Yn*nwKw[p$9]}O}paU'҉pB;)ɿ܈&Kft-.5P݆|EљXoPp25~k C9? S:ߢ똿p Q3~q!sֶ ,:_cIח ~=!y5D-x伒:~}sV ԣ n3b^X=|ߣ}-T#(F,s'l]5 $;[~="H[''q"Ve^5fNu^9^uWzWpT=߫Kׁ|7&+>6PcBbYZt͉s+^_8a}n/Pr?&Pn׏)E~̄Џp1;+~Xp0r1{b])`ߏ)^đN 1^?&<˷M Iw$R@aJ/cD2xL&D;Dx()`fJӈ˜e@>HwAYbg KJZ ίg=qQ+gOcݚgwNQ=p_'U"@i "ci}@!\OJl`=@l4rSJXO;`=I)q+XOE u8z* c Sq bv8z*aUd'HXOC,ނ2^<ţF{[?ci8,%'$PB@YJٍ*[ow?B-NK]퀜O|]r:>_3ARuN\~ӧ%'ӀssQQP6 ^m.EOۙ$7{9'ȄJ$d"PȄ6.2!d"I@&dVL+paxLȜ N2a٧ NLHBdBD 4{Lt82!Ȅ N*#X0}uDN1΍lu_%j}(`-f@QS_9~/NLXƬj$ pƩ@`w/DZ9c5$@VJ(_tKM}(d:dz[ܯj7@>1o}:*xc՞q_du swew  g kͯǬ#~V>K)~g.xPAW,R\ 17ďnAab 8"0$LO` -Btr0a3{>]qqk4=s1kzĆ au;E˻9[p=7 A)X0z=2&l׹\ǃ\yG~lB9ϯot|-˯ŝ|Gβ E(~-nv2Z_:qL_\M2 k{9*%,Q/3}~,ݳ?;G#x}!V~{F 2 2ZVqe|!P-E[utr;ErÈ1qttPt- `@ΏHnj5GXA#um'VhpB a9 ,a j@l).X-"pAdZdP  #BZZNx K$9XM4a#"'*8f!SDh9& dZYK-'/^#^Hwq _ 4qG|qTrYF'۽8wv|A, I(.ѾS.ɾ}v)el]oɖ/Nzԇ{=݋3}09";}` -:Łs8{/XD9(-`/N2E[֧>܀߭[3>Nbۅ'M|Zۗv0?Zƅn-t5jժm\^/V~a`gc:>g6P\ݠޢߏm*lㆇ +gÅ~6$.Tl", N|?[oĊgq wwk2N`Nqxm'1xͺy+Vd2BDQk`kd4 m.tT(jj$ YYopTEF]kOOQŐwNn'Z+^Fwot7ÇPm =;VqS_ՙ)[ߏUԗ'(l{GqTQ*n@38zdó:azMC+S_y~{'(uf6:gk[ofz,"``Y %ep|7r6:'V~ۉJ۩Is(=~^q{se|}k4:ޯv[/KV>q>:8a@Xcr(nU6kXyjn(@b3$-%įv:?Pn"| "4C'>"IHQ3&mEOtg^P t\TMFYѸqw^c4/q/! M ' "+ {Q "' K%CDCQqȉ |S+uJvz`)(M Iw$R`zE"YQ&GЇd" NLh_ވmcv͆%~;*iRF$E}R3ڽOŊ3e3|U*fv; >SNj#}8t=Cek: 9@|[Zx(uЃؓ3GX=1{\<"U^~L7h#{[E=R no4/jٰ4{^{n/$ʀ)_K+e$ )*_R}yZ*Q:)n0_߸e=5sFu UƼCA7EW^D}}wǗ$,KFYy@K;jӪ [r>raҺAl҆h<RAa:މ [Jr%B/j嗅wr9G=ty;³>1H頏\PǓC ħH+'^ׇUXpkuqhx~xA#4A#<ős_/+nzCCCȚ `>Tw&_g6mMK)IqMuhZ߯lhoL5R4FI='$OʹP@\\"E'.5aL*S{]R,pfΈB.P E" HlOb@("'X@fJ(pB}axX8IVX+) $C+r@W ';z=VL~,V2ҳ@Ϸ_1BQPIZnI}fy>xp@Uk(Y.ᔷfIg%L ڃ[?ȼש.S6xwOGkQi2䅄ֆ w ψ9Ku@~os ʯ{{*Pgٯ:{犣aku k"`jqɵ98tp>_] l#nk/.!lrFaڂr C>`&Vr1;Ké@P8v OkE_p"`K~uE ATY}^D{ >yk}"(Q>P{^|`3$)>`\p Ce7Nappc?n@yw`q?FK >:gRPC 9| At>`BPC Zl0D8n؄t9>}:xgto`w4lA7jȯO4<^TYG+@2H`ʠuw&>`8:_d82KNi `+N ʱYt~dbyأ>_anܝɲvŝ k9ί {w;Zb: *3,TyuLxU+@!^v{mu&:yIҶI]ܙݷ{·A% Q#``d[b[tRTNL-G0G$7*'-qԫTN,cʉ@!WN\r"ȕ0HP9! b%TNt8A4<ĢeNX9Aʉ+` *'$C!-s q%p I'eNX9! wbWNX`V=# +ksRdpQ+/rBLH Mr7i|%48-Q[diF7XSB%44QQdqF78&K4ĉX'JKhiw!҈DB84FaUVF!S$Id|FFe>~ӻ{HžyROhy&H᱆dkjkM/8E5R/F/gY juY֫?:a2Te J~d_lW孡i'c3g 6ХMr^݋:J}ԋSʙ=WGcڪkII.N),oL?xO,E_F\g,V2eܹD) X.v5S3޺7m}4Fƾ?6Y9ԡ氢9r {,ּĉ6Q36YEݢǮv_Pw1Eml%b%)֪Zuf"r!K/tiqMRv(_븮fš18ҙCV7/~M Swχ~UuͪԤa7 ]ZM9"=j37/JoEsWz?|z: ޜS ;3cbg sJ7$/[!9چ?.6$Df1mN|Ɩ3V.{nu 9*SG+tݭ5jܞLsN暓yNbKb>&Ryu>[O %3lb3fhl'|/\F8VЃYp(_홝Dzl;k+򟘻5͘cc5=튣Ic\G)g\n&5q.39lH.3`k QbhpDDs.ݨv$@3S;d˱(V&S纹2lC/e]_zIbVd(&kb2Da"tu|e29=$Y"&Y f!T%r6ayHFD ?&Y"DFV4E0dYaTZ>E>}by$&8pGD4Cm+<-OH Of$}y3>r,}y3,]b7?Xi.TϭԡƯDSzdezepA`~iv_Vi0F5K92qAtGWOGegQ&8ak5_By\Y|@44/yp_Q\#GP"' endstream endobj 345 0 obj <> stream x[q;G9x _E$>8y0R'C$Pw,grTmPdٹ,Ϗs~럿ۇ>Oݾ{駿_ӏ|s{~}=zG{[ot7m^ݻۧ}cno`B|F^{jMtկe1f^_̓[ӿ}f0爹޹ޙwvA]tBYmx9X}Jn+s򵹛u2f5ރ-ݍoWSbۼLz3޾7or{>o=Dݺ{}fLOIIE+Xnw/z3ɼ/n~DULXr-v C|P\ɖL3LHfM.e7׹BK}~KjL18{/aR$-[,oKDqm6XhYC5)ޫJEr"s_r[μ,p48 4l_N} +{}>N^M[Đ)هB…DދY^O^t*e*[cHǼ4 M9j#):r*IJ % 2pzUݡGQ\M~C&1D&V?ێ߁yuj6bĺM:كX}݂$.Յ]6_S7~`l:bc}#?횹{)9JbO5z'ce09ɔGkY89c|loɉ6>AO%k7k$Amsbcao{*L}Ǎq9 3\N#SH4ܚe%?Й}7WDD/V2Nr99LPOJ4ܚY}+DLZaߕrjjf!&'}!2HzZzZ&mMR "\Raޓ^ĬKuJ=zV.u x ゙m0k{|*Mrv*)GgQ05^X'8{ǿC M$ >R!)`%dBc"6anIFAD .TpJ0cD,̗]&b^:Ar"2gC'HTsY"t8;]H<k-w(q}ټ$W\B$zOWn^G6|峒X[n"EM>/T㧾?Ov  XE%,r^x7pf0*Av% [& JR>D%)^Q&sh~(%MK QpD8NPɤDbBjRj `_} unf÷/wJֱLX?MW@2¦o U7$ ʛ'ȯj_s O{x5Iv7@`^j7τ c} JpK^ 5[ a %% lqM0e 8;pz@OЀ`û zz#HFǍD牾:] HbD D-ċR$;d҅*[ʗd"8u ̋Uq/'o*WFo*/^Uny뷽ӻuxm%8EKǖ+etm\[t9=lbzMHRF6Sb̡Q`֭RQ3Wʙ>h ДHs(k5٬ʭTy]PܼRo4S]pHi0o.%<̉JX5dŹ̓\tsdq)7Y%I +@8(i.ZDϭfg<x>D4 BwZCS2*r6, mlt;KTi|:Nb5˗ 7i2qӵOnXև{5Cm'@q%ORu;L69_{/~_Ysl7_?oW}jV uO@AT OG. pي[h;;ʶ\jKH-N%. ^ѕ4E(^*Р\uхy'G"'p'nxcXNKS F%l'hא&F6itb'X;;ǽ: f@>$%$᠌\m=>w㌿l7?/b '_hMۢ1_}Ǐn;C@BC% #c|BxBZ=̡2՚le_I .Q| 4 7>Fi(@ΫP,d˰/WlSfaR8NaY;ūNqe{ƶ3&T`ԍilmb2ƕ qri00_||S8 *J@6]{XгQV^#yE{ݛ 7{7o5Con_Cw}&-OU:R )B o@lc $ͧرĔ?ØmĢe0`ntGZ- ՗_ؾ9lo+. 7b7Vȕȓ LKT IJPG e= .esB&#WASu٩pi{>%[G^ dHTB aY~f[/zD?'c^H2=b7RY&}-#N}NM#.n9f'^d}XNAnPmR^dk;}c t60X]Rzk#-15ߩqw/Usz_ ll1Tɝ;.M'pNܑ݂<vR=tLsX;'ZnqX{|b{EW*R.k,]X=_hpq~C+܀LzV>x~HtT#9\\ԓR6Nx.k<8P%Q י5#)%e4o`;|ciK`2 0wGfE0w30p 0usH[@S61+i |RsluWc9 *|T#P4<'^lm|@ѩڙ J =\PFu!%a˅ $J|͊Gt@M v5M\x1 ^4'<;-sTN X09\s_îlc $&qaw(i= wve-]65 uW*R'{N]r vI-RkEjXB =۷pJб*9o*CVm|uKd7=hFɬt>^Y1.ΔYӥ:f*n1X) =" >̔Yq`VvYrGK ^JE f)b̺4Ub֡-YT)2륢[̪.:j,w fݾV$:zUI*x*A(]‰F3 Ut T z_=*#)%eTեɬ~_7$f=d4̺fMWꘕ$̺݈͊eJV}JMLv4Mԋ[& !m~QyFlb5NJޘKuoʶ^ ]K_v *:[^78W.܄M9TAr.YX+nqX(r(>&"箔s1u}$ʹlb {EW*R7s7 U]_ߛջ `V͆Y|o6IfjfOU{GN%Kbt{MSo6J>V2#)%e4doyGrQ`7t =YC&v"+͔o6je|sN=YcwmQ &ͣ\i CN== .Uo&nXɖ |nzOAHK|;o7vrGL`ShԭRQ<=LG[78e ^ѕ4EGVtEA q\/u5NWT#u5Q<| .㻚&') P%t5bd@z$%$u+ |J2|":|"fŮy܈'}]MjZ'i纚ċ{zLjRthk_0Db5N 8Td-pJ'I}KEpO=wwƕmq,wdc\65uW*R'➩S7-q,qdO\>1EW*RZхz?\}8.ԇ=;ݣ !SJG#GQv0:eMSYT |-`nQI \I2[h 7Y Hxh1B:p yY Z#E8Vzr&~zL^D7΄`Ku D 9.dσm7r,t ؋ do(i˳@]} @.R٭R C)2N5@J9$^ѕTEVtk ꢃr NF4b1IT%QHYz0: ;@N!n* b;y@z$%$xX^iV:T %CŒP (%K2a"ACIN6S9^Vyr2]afCA@͠q#nhizjoB+tV{| eq(;r>3W4'3A%+~NG 8 mv,{au˯T+?˯4@v*b'4It@T#,@V@VԓR6NhGT} =A[t(냶5!Q / AX(:h/M| CM?t!,CYd{._x9 #́;=9sL~ x:R@/)SbV(.LZR/P%v "MWj&qt3T[,9;OXK 0WJEVHb/F%n"&`Wt"Ǘ!R# ܭ5Anz/!!SDJ"H# HQOGKAʚ E2CG1SoJ =\PF T`ǽ9d%v;\ .]bǐ5+۞.h0\8j.ڧ=Pj &~qmݺ3C ]1rdUc+ʪDU.Uj0 VmXu(*ސS*R`CUqQ`C VmXu,wUuTg`)blU%-VKeU61u+굢k 5XuC ;zHtXT#*XUXUԓR6sUeMSٹêG1}{Hd "Ѽ\U:C/Ϫ( jѰ+YԱ+YU6+پ>pJб SVVTNk$d`VW d͖>i:ܵ}:a3.:¬pY]ͬ%fs;4 |ͬ0+x+)f=S`V_3hŬc#'&]JE#zjf0X̺!==GPF#T%$y*ɠLp)h٬# Ut*#<[W=R1LJRzD%)pQ&Etʨɬ@2f Yӕ:f YEe{_jeZug k43k d͖>i{jZ8r% 8G D 1]|-8&p%4pA@DZ*..5ݺ+)1z:8ci,7q0q#^ѕTE7pVts ꢃrT6kZ{c(ˆXJŐ:+G e=HFK8JIԔQv 1 Te"8zLmvJ =\PFz8nq; 82pĵzҕ:pjdnrʛnyqOuu&ydORdj0uZ>q7 @0.>Z-tV*-|KD F)(ip> o,>n%ĥX[w">+'LS4[48\&HWt"M*KE7{s]7s$[F軝@t cnMOSJ N*HJ pI"BUmn Hthi.+u4fžFM7 ?w#^}|=*OT:s-U@-)@b]\șp ,vytO>qu'^;SՁAjVuJ @ ^" ,zqҠ^vzrGK ba))wԋSPڠ^rzP_{?~U /{3@ dǸ>H$< . X,:>A |U鑔@ D2"',Nq]bbtWhVD`EQ#}LM r9~Wx]L= ѴaKuD!*>GB*7ߔs[2 Cqԩh#/Ní 0{C{WHA:D8)8T[< 0R*#p4 A`L]c4Mcet/ k:π?= Pzx\%~D?$:?jQ# Ot 'q# Xt T ?hএ=򓖮~Kάtn f>hNQԅhB eĸp4'ʈ֠࠾\'2`= SI5|GN˲_韛voloseRU907f+&yn#?9.f^_<[{k?nhAG]`8eh^mxq%o|{z:Z~_4L#t׭ݷ ̨>Zc6^ͅ~:a60`ݞVYRvt2nbV1z|0O \RNƺ!wT-nIy}۟z~{i4.,_=Z!tRY7[4*Z\̣?1| endstream endobj 346 0 obj <> stream x[%ɍ;s&nyf{ 0a^?~33$UR1:PD蟑T(/Ͽ_~˟~xǯ}9^~_sǾ,e W_фw޶7_߭Yܻ}Gxۍَ7~~Ut*w=w7{cnz[ц`_W/u{=;O6cfƕ{ɺkN3^ncy_`fe#l<s5xY߾7_Wo/3_~럥RW{ž~f$֣ȇzw__]p{3@{ w'ΖY%of_V{ Y ~qe O۞;{7{ۖs(~qbe'~L5Zyz|kX1|~=ΫgN8D}t;R{f6-Ej\$e33a~ 0U^g)| hG}}Dg0G3#a@Cs ƲkA<%'kGgw>#~v Y.3c1\'u01{Y4s,aczݳjI xeĚW[-D'@7&Fg DZʿG3+> ruZ&Uw14Ix'Mm{Rzu鯧셕Ip_ϫOj>#i* /­5 #ex.U{\)Ŭ5?5wD x( `%4 N= xGRi Ei-؁|^TW"кߟwONϻ]Tb!G &HqX "}\mJ蝝&'ǐ׮c\ ȯe..x||P;.(*[AIn#:yq_:Z0;1.x8]ŢNԻbqD|7#l9Z`%:fPf?y=-Gv[UGS #HQa FQ[j[}K$ ?{rj|bZ yNvbԍ9Fk)F}AUջuk <S.u#Z^ #cvߋ{P $20BzWM*zob;/{[cl E{f(c?Ze[) (m0%2{cCX~)͍gM?Z܆R'|Ȟ喀ᵓIZ((Hj1A D'G7./l0R;ܦ3C,I]7%%i }n!U_ڹpc{JP~C^tom{[ %f>Cfvonn;kSQaPn\M}/@{x Hx-a/J;qCz# y).h=];n;|׼ x)ԯoxA*DF4TRnddom,Q|;I+፶'%>ii_: <훇R\fA;8:XGd<42@hs)L #O!iCދ\=؀%Q3щaP+,F0/ Ò4 Ze6\)  # mZ=vbI-/6)aǵ%G\M2?'C j/|6P06"HbCo Ө$2 `Xra! g T62ajGr;@i`<'VhyNhO@H4d#{ Ϡ-A  iQwD I dx]esٟѩzE ;~m@eKSS*SȨl8}Vp5{ >^ZT _IKS[_KKwK˻_k9{2#_CQڝ!g8x% gf<Λ ;{`PץD!8-u{:SC7 _۬./ "2%5>yB̌./s1 WG;0VvmU~K|I_J .AD#\_$ jR $I2I6gBӘd  2C6k[Ԃc̈́'vL^{s`mOC2' Z8p̬#9axԠqa(H\p?7nn෇qVNiK%!|sŸLcK-?91#8{H:#xis@\i wnsm'52;ÜR⭩`aN 954$ +okp=LaaJ H"^5 (0<:vh,_d{c{-Y4DЅ`I/6uh4({hߗ˫P,X?"#G66Gj/ o)G[ĂJK~؂ZKfc ~(S%Q ,kaOGtDmcĩ Ⅎ<}융xGQ]wlZ 5~l4jh[0i8pvoe%" 5u3xvosf^4_­{1h6;V@¤_kkYg{a7_Y¯*S~$s*:M2F0d4`B̘ 9Gifƅq5>/w{ܸxKqf~)1/ͼ=LmG&dQQ%9dǧQ]8^D̴嘟_\C|}Uy2%0@14 |bn…u\U .}̴=`xiO3;RrW\L+pg;1SFXĎQ;a 䄁\| s;I1pv!A[DNo Rmma4$a7L%Phi$ << * i0T>C8~L,VsH{TGW՜'O8"]%^~g;N \| s;1금"Km?&b!2w;FE!wP@hki{E 975#4(8؄ Q0͔\4(8Ħk- Nc)R%w*7!=ۥ D'GWgJ,m,K&8R;'t5#Fb(1sILĎ6rz* &neiaJ\K: W5-Ԕ;p!jĨ) kA4H cPB X't w*^xg Jlm<%?sRNZ8|U"7.DB渮U _m{ͿMbdI*s2Dʜ>pKCQ!u؅!|[BC/efzۜR-&Jηu-{HyN&UUL&}*2'8> ;Q$uA C[B+#em; )O7'LܑQrqN#ƅD1m ɭ}#4"T#3@ 90Q.px6(RЗpD e#D2~>K[B_W!a&ٸ%Nz]x/mMo7s@՛ & S!<5`ikA w@JϒrL͈J  46)7r>!rh%-!N-JK`yoɁ7<8 ?hR+¤.A4Wyz9B#- EMyGÌm9Ztpч$*%3yQ*IÄ͵=ckSaj2f%M/e3spU]6jv]:Vvk g+VI^^yEvkk <#v{P 0Lvʢ*C").@sq~2 m@.Uі}\{KgjC:U(#];UޫHϓyu|9uӽ:ok>[}b]}l$uj(!<`Ը^4Svyi;6@}$}[U픧\7iB FgiQ#2% \&EY9] t1KCAE$Ci>M$~Ta0E{Z1WS}@IL.+<>I\cIj®U^K kn'|n_mfhma 䀫)">bs?Nx8]( pnFry}Z[W+VOd> T-\13 ĔpE ԀS .-F>Y:-{7^y±9u)zBs>x\|{XtSAɴu-6=o|k޾j!^w`J9[>EH=g5,<[?l9PO-Evf]rzmɗʙQ*9-sV"ۻD߈,h4[B/ ʜ&8lPTEirYw]xf,Σ-& l SbHd'LI?UeN&x|ۉ"I$:_ηifwȑ¬՚K`h S=2oQځhNWL-Ϸ0dA;2.Q|gn&_ęN5Ѿa8D *1[|/ &p T{s;QFdͱ#9ߴ=V&N~}⾪&1q\ \Rę].2iPJna(}M1*ECus19ն4Ք:hF^:J}pLvkh2 86%7A2-ӅAgnJ-e} +t(_;e1F; dyN Xfd\qp-dy˴;Pl r4*Jw"-ͭ"Yp?}BL3Jw0eT; HU^z3Ŗ,:C)d9 L"GE&w҄`O^JB+܄4!,pބvcSe-1ٟK f@vtGJgs[*ve0&tu?Ɛ֔.@OjKt'`N`w7J|] 5ofV .cgj>;X ?spNZ@hCw.ۭv=bCM WfVMC_[Sb#@-A!]h%--!]N-yJK@eyoɁY~gdϼptYjUhrOd&sSݗ.OluAGu ri Eol> a`UųȨ<0L:L[&2Z4e*߯ U+¾/̲u"mDúF+Z8}e5l\&}19+zYA>``)cc'o{d^Իx)/ۻeגt0 ~+NTQN*l Dq[Z3;qz"xj,&@-7ضF4;'2@MiChxhg)Kv#%ɨx6lbkq.zBOU>d%<)+iHkKcw"5ڷMؘ" W`h#Fnp'koJN<2>WIkf<_ Ԕ\G5ra TpjAȩEwҳTlD;1~k';.&fW(|AVVȠPävD(1] ьN|tүg #':ek*Kŧk%aзS|⇆j1Ž n}"JL[^cDCCע~ N3Yf{X*"B#c~MN\pt8l_/tW|ʻ^2]RO(n+ZD9X,d(2XYi*Rd0)r66"x (r)"MD9kZK"gc)2QrQT"4UȌP'J jFWl 5ǐFqEGM;küɋTg; ,X~ƣϫ}6_q*sp7` +6Wt, ӛoKo}WC<ЫzsO[sy @r{ {aYZ 0OӸ~{bi[:BN9m#DZOD~y?y=#^qCE7wc`N{`\p5j\YXʡUi% |k9t"DөoY1 #O_P =BG0M#~qϿj<꿪\0v <*=T$Zpq<ŝajXXʑ',1E^(96m'&OkDKX #dZV_SP=(HM#מ|u?yݶ!}ǸeT/MDBE+MՋF Kc5%P=OHh$7Sh%S=%z%)-K㩞LB) AX`ɟ{|J;^{Yʽ)*8-HivmiK߅X59LL{jheovB3 > Bcҿ!V *BƨVz=IΛx> avߓV{19T^33=Q%dBӘ/vHJI$:Jbso&|)ǩn[Y ԈGҐ"-:Uʔ6k:%)! :/gJC^GUo|r9WfWٔ65|c(`_14sʿ@힒ce1m+H[/ֺԶS/,z^,XbF#^l66^lj -͔P/h VbX%%^P4<^2QrQ萋(~F=h-`r8APw'{,,sDwf %]/j2i2OG{ 1Gv , `2pfKCAU)t`.8v15Β>27yqmr`_ U@TPYV p|6&v<\RŵIגʆk};K+LON|0ҕ&C2'*s5Z1H[9€ESA *ioFڤUo1G*C%8 #mJMn(eJlu<?Vp8 I居/ _%6wZ]z^_r8ױ~bDdQefXVó!04Q%fП|*XM{I:RemrhG!.s2c%c9qO c ;AURl06IeQVU0xϑ4e%Y0vN BkΛ[96Z()ԌBZ)HIMcRh)!VX))6oOVr B06 O6Wv[eahQnvf)Bɼc+mdwQ`$7ַ6KҀyW*ı<68RZChcyC6783o{[4Qų5IՉU2fu_a@ endstream endobj 347 0 obj <> stream xK%72ݰO/ a潙t]fa¨E̿I=IhDJd(ߥ_{oǟ寿_?|~{ӷ|j_7Ŝg_u{O7/?۷Ʉw޶wog[wo?Oo:W[\w?w{]Gmz[Ɇ`_W/u{= ϛjضqa/)e=G/o+LͲ,x͘b/?ӷo^GowɅdjo+96d֗}&en6^1^ݭۏCq6eU^緮U#Gp[rLj[ˮX4d~Z&qLu߷=߾؃|Sk쩽ֵgīW/ʲ|}]YW/Ǒկ[C!}]sr>׎e{ULS;5أkΐSq a{.g!]oiT\núiwkVy]zSu16slI~]˜_ˮ}tl,#[~경Ґb 3hS4.ݏ9C.kFq>}ĥeWP򨺅X+l-Әn ,ƭfܹQs=믚u?{n^Ƈ!]N⢵al {gۥ!}nw՟;w})3jngpn}=.[-~pK| oʿO3|v9sYqͤw~Ao(qnL.{3WF:1{)p'&ž9gĆʐkavU'k-r~lQ'n>@cv|^|ܽmk0#"wg|"{+!Q 麌bO\1$ E728c~Uϱu8tz/iV).7 e _j$dVYP 砖`}ڂusZ Η{ ڋf{RyBwvsÃĵtF\Vj6vKϊ!f{ V@1q'DiZ:c Qy"o!Uenά؆Y}X}<ٔ0 ~NDX"X,`i(H.&9*KA>*?rʨ?B\dkca12vLFD6kgBWMdk)4s;Fgr񁁫-N |\,瘪xtOK;H ;6pOK #9&;i%Xp%E.G0 0P.$yzAWX+,Rس%P*DEuńݶ{X),LVyPh{e5|2"ۋq^6 \X@sP}Z 9>(62>b֨0پRUYL#žwqe8b@<Ǥb%` P>(EX."y6_(lL_P?lk-&ܯaǕbXFO> 2,w&,a⼅j[5"眠+ߪ:/#۬GܧJ$?A_w'GX7,a]ǺQDºB'uuHXKpXW.uNE+X7`]i0 &"=yTtofEcaӂ-Fǹm*ԖWk^k>kQB׆ sE?rd~fp_ r;ȆA޲6cr|o nNmAi~w3o(:6t$UĎ10;C&2:|bcw4CxϖFκ" l ǂ[wn& \CBY ! 'fCۧAI/ *)޳w*q;a7 Rϛ>|\?5Fk̽u>6WcM A.!&|dLV#]V{^=)Ү^\'FGg|96 ]}{s9̿/G]PZ1{hVU:m MqCd\8G1‘G2Y8gwkөK7x80AZ^z~gܖ:4U涹skptyݞߣ-v-LYp٪Qؚ0ol$+cbX/p1\Y`ႈpN" f#napӌp pAgRp> W#2l0}+Mj|A3ZmrQ^1He.λ$gUII΄s8)4vJ#,5$^}C``H2(f2PU.Sی~eK"8}ɝ75M5=\,sEC$k83IJzE"zJЦF4|_!]1#kCOɩ~Wjc6IϏٚkn>>bpfFjxjkX 9}U=pz앍{:6O=4Eg驱\ifQ6Ώ-v9[u->~Miۺ3jF;\J,qP)Cф1`0CL+~Y꺻tj<x*Hp$,IAO1$> JN)Dth8pX0g:Pbbw51t$rReui%؜^Zl!(mFpM=t\DNmQS!K)AK<<$2l{?56!}80jLJ2 viüJ(I7=9%plƤd˷Ta\O4G4O{}Tf3nSqgg#fiRgs9T0-:OXf:QbBmbߛI->:UFm2<f`r G  S7"R :<&aJIJMHi$Dw3(%Cb'ĩ'+='NA<1b;n+6V0鶒H^AM7庢pQBĂ@ A0_׈_OiM[BX[,>SQM% %cxo:LMUhlпOOVNPi:O ZnŇ#$W~u :Z9U۲k$]>xH E$Qd4ZV|3ݾH$ eŘ䔙 2SEF Р4$D)GH1*8/N&\ƼZ:9zoL[S mQC/SAw!Kqu& 9!4p魢Pk-ᭋi[3[={Gb-B ҉?7l ߦn$| R2Ud|M+*6M3%ۢ+߂of=V)lx,U<\ tDO2-?!.eLeIO2}wMmrA6C<~ⶅUb:W5Z0n6WT,&pm%Dp~7U5vjte_ڪt@3&08,#'B-Q}5'to'6x'Wt;&"~A *9S{\=5,$e4+c2?=|;$ǐھf\j%ﯥoPGԞƵ}OGÑAuQ<}IW*ܩcPy`qJkt]&F j9sDŽu6}H0}RqΧ:0]OFFa~{DX>`=nCLwOߩ9 VPsBR<+@@qJ{DXE`ۄUIehɿR |~9eu5eS @/?:܉XyGQGmW]vlE Q7"̋R ̓&+T&NUטrGU7|-S2FJ9[&]j*0F(jWƓoˠ*k69 j~j$zC˩^d2^@Mױ@v*)M]P)P=tћup𦪀v;\6$ [&۲故 TOq3+i z}&TsRiHhKZN )D"<.U2⠪{ ȥ7mS^i1џ*e=|7-ڒc ⠪<.e(kY`zY(A޶P,[N:ZՓmQC/Sa©d92 l QMMo uzۖM[^iEpXG dꠝ@a⢭riEک rԍT1䊩JWC\15P15uWLUlBJ3%TL-b+X1U yhꉭ<4 Ly D نM|Ll> #qy88Oz~?n%  ڪkޗtƘ^VWЧo>+%F+ ]SQu@@k : zdp AۍB}1 8Ի&s+6]Qҷ OD!8$*<ik[Χl~-./[j:η~1b9JRct(2c{|jvi)?zt j>Q&SP*Tm;ʛꢊ;%g}-SO9gS{Lzvi)(;U40M6S+# B5.s9g"#q)zå˩=I.-SPpnm&Uϻ{k~k@:m:K\Q ep9R7F4 {!4i^Nx-hS%<eŨ}(mV$T&Asy&sNyiE_ Dq6EZe8FwYyMMhSEGyJ#o"llFb0TG^Lm/kWDq6%(F]EH8c8$(rm=Ũ~(ndDq(:# Q `s66OCRb!(;]VV[3z;7n-߀ޘ REK>@Ȇ4%MAtp#*r j-ohp :!sj=!Tl"JU5[MR7Yp!eEU+@Q\-x̥"fsb"ITUo誝DQ*ʢH2q4'@ixdj<\ tIүdI=r.Ⅎ<6vZLTHCq 9?H-ƸgG,~\(Ey1+ʎ UT H9g$k'Fm͵K{q7Wr|{XS]zB7E&FundWY1tcNn?p푗$Bg; : 6!7wjekk7\~2vP}Ma5}>AHa9CsU–7Bф1KE2N9"L_ wr٨֮{r0,XrNcC{[W;=? ;&s> F̝Î`94OoȖqD&Mc\,S o믹EFG<g;4ǝW}e 9l4`.Z>Ny|I|Qs9@<T?]Atlr_{E=BL{O> @%20w&0Ѳb"7NipIo1oک| 4{ɣQBIn($]BJhy4JɣrOHjSO|4<>yT; ;#7? ܍KQ)2u xV\V63d{E? Wp=p<3Ǘr-p}MU|BNɤTtWҘJW֦&:~^i3#|(-pꂾ~'d<'xxܭ|RNܭD ڇhf~qTd񟟞R^9ӱYh|>)l yOZ 11ߘ)ó+9r\%wI d]Ә|BNp8@0u_jNxQ>g:b*pCF&[}$|@!]GsVfB"s&rl&rBƝ~w~J;3OF.ERT@ȍ l$'B(PAP?'z;1o{IxJ# ۲:̴藙ÇOWP(М>9]C/Mo U]ѹ+>? /Kmȥs˜*D:̊R*%ҘR"6T6YR"oDT]) CMuY AYjF.))(-9]:SSĊS)4 gGhis<'ćNQ.@y@:e!ȇHsCKhs zI*vΤ _EI8bMJkЖTg&L. l$`rBT%=S)KhKzZ ?UC )wZI VXk!y`蘩䕩ب ,!1 A!:\B[T[L[{ٹeRÏҖ \3 KU.d#<IXr~ KsYrbW֙2l.үbm=蘝䑩*fa$mrq l$mBdTE?ӖY 6+`2IϩQ4&Uza7(ARF 4QYbݢfo.k[lZ>rƂY܇<Ԟ2}?=v`YJLDjJT7J(TnRP(P46RWՕmBK3%Qݼ+F)=!M=TW nOu)!_|NVݞg9G@7yjJzwײXb RNX:}ضG"5Z=!kST]Jc"N%k!obk,]է=VsEWYKl!8b+<&w8>ؖrs}nMGl) 񂜥tOnmM^@lbi[.@زtb[ !RecvkX=bLz gS"~lӲy# :5IR0Ė l$BN*5Nl6ϕ#IQ3"~SmF옩Hlbcai[n ,6BlKA>:*[Cvo3`Ť&/ ^t~կjp":I6Fk86CRqm!'F Gp&J{n3Tc#W*Z\cv" ΝMaǵl\D6OCqm)GQefmkIw\;Om~ŀk¤έwKrQhN k 9!FbqZ{= ,) M;YEsN=P`-v"[HAbG@joҨ$N V)-ΐixF{ ɈV -Z40ϊ}G5٫go0{DH|Y2mn ʐ*w3?ա.;Weso e< ר%u5jPF<:sUk:P&W^Rul6ciclEEY|Vdoue(y˯y__;x o^oueywꎉ endstream endobj 348 0 obj <> stream x][7r~0"n~̜$<`8ㇵ׆E}&k %MuUu]H~E~?]޿ws_w?w?w~.Ϸ7^^> ?z\mD_%g\~o|yJrc7qՍnƭB'f>߾yq8VBm\}|GPjӦ'A~⦨I򤟜b>?bMRKo&ߐXEH+7.F?}'.ڨ0b@޾7?_/|ӧ_0i̬XM k$u_UYz]w/UnvM҂jS⢅Yw'T?hbW9IVE.;[]Mr tʙw/?]o?FnVS4t튟]>8l;Kܤ=>KD֍gt}Po| #(9qp1SY6_L*z3g&%:@{b$R)5*4< I6>"jL UIq]`:T}Vj{W0پx_@ dZL o8.:ɺ$ScL0], U.Nc(wAQpYȍTZgK*KOMؙX6Z,Iq7hcMIHc68NRBK~ I;v13bdURl:{RntL[<&~?#n~4'IJHUbɏ0ㆀl"_rWc8T1A |:_cK oJsЖ/1ٍWɥLmm* $Et JF_N]fWc؜Գ* q|w+1A=BMAڦ(PTUvlC%ICDx&Tfb?U' .mXIQc<OC?-);nI]OLɬ!ѯD"\|-UW%&g‚9$mRAl'^3xQdK%7Z͂,QO ~ΏUqg9wcǏ* ՚:Qk LzéktpqaɅ0 J8PKFRNgE l)'jJqIh޸žPX+~0$ A!~2KN/(idPQxQfkz}h*ݺFx.]dVӃww1DI\ (;{X h$~3_2-F`*=Gy (e xJB]8Ѭ*vqay[_@%w+SRGe"JRt 3˪{Nj!!H"b}%8udUTGAݖ0pم{j1IU ǟև#V-ddmU9 E򆴕Lpawڢg/ƨsbX[%rGl`slHzJNObIJAؤ2BMk+*D 'QSIb-T@9A%Peu8XmJjK\(. 1bswJSAScDkR76^͊ ED`T6x]{adSW% 2&RC6,p Y PhiB?/qW~0*'E_nQwjt(c\4Bv1t T&u!.s0*;'׎9"yTra8K71܎Nܧl(`6Ti3N3BZZFzؒ܃eU >pHNMT5Q]ƳI++x\:i`UQls# _8(6?YS![=_g(!-hsk5( |5q+%'J @0cj[2Z8.HDl'+=QrDU8>r JDpa7K9snm%u=( ԋH& p:A za7BP/ Po zR(-b$&r`HnD%d|h,> ;N=0}*R" a QYZQ@7S#` 7<.A wCޭkrЙk!G Pq6|E\wC'f9N7$&W$M>F cUӷtSrUdScppH;qc'>c2-NGep)ۥV>@CNN@%'xih0"O5~êPB@1d>Yޑ=A!{@C# 'Vd9dT>a!{T 츥BD:1AtX"O'&m6h,>dwDP|5yv\,م>N_,/E*ĺ@J4ݾCT3!Hj[2Euر * v.Cm]SўBe{׭xXt$߉D{?ʺr,!0+#@;d4߽5BnxraS܁'Vʏt+-l`SQãK;Tqٝ-/퟿CC0ʪ~զ-7:3we{RžmL&?ت~HN=[2ZŖU_=<-z\v-v犒|[ÃKت= nwlN~UϹ5eح)(&a8L 1'.vbB@5ćF$NHsH&x*B qK1cs=&nE.vd4,>5$hov~!q9z= Ӿ<$E!3-vٍr{}<1~S"ZN %snJlmd1=${n, l)-l93B+]rf8ál+:2 J> ]OGn2/$w>v;NvJ8~\%g*d]5ϹXWrf>.-lԉ x0>H{I9.OَVmo:&[VהÃ+[vNTzUMܝp{_ʑb6!|W`@5wFKpsp&n* pK  cDLƻ(M4Ff$L!xr"@fޯhy1zzr_j<UK/zQs u1@u5 Ō՛ѵMM:NsqkJ?RlcYuzA]C# %V9 T`7a]T vBXo )1@1 y$PPF09dI(Mr:m zDZm'oF3?~CGIFwx94k0e4%`;k:Vʵ|?KwN] pv w9cgyRyYy(}=Я7LML>ɲ}7y߿eD 17Cի$EN`3;0sʩe[vH""Z(Zg5nj3YS:g@)\gm >_¯Fm Ay{*{t~j&Lʍ*N$1qL3~c{bu^tO,/(m|JVŹ'rDuЕ&`F%njv0B[Э˃wKZ"2E} ~corѡA #{yN04thL*CK*}䟭[,BENbt㚊q*2c}f4)/kP'uhO$J 唹-f{|9¯}|:-T#oJԍ6 3gC\Ly50?&_@%=tc gqW7*DOZH)* eDm"1Gd'7c Jpx& 1*{\_ QX+p'j +[|wY&v誱9|(,Q )V(̔k5 <^!âV[ +ȷR< DJ(*Kʪ)۬TSz}\ "n,8vEYem,˩eWN, J%VHe:eY'?S2`HN?IΉ^؁5aEgL*ʢqy%{͔C"8ZҒ?L֯XZeqZVŔ~%Rʦ^erFнDT6(F 9{̇ 9x<&}G@3QvbM/1/^܏/uDeQqK-ڤU9FL, yߚ9L!>;📫Ms.TMX|AU@U۪+Qj]*FU8|)Zomy TΒJOcDtr$qfQŐk*$ᆱS1&횊q*v2E*k*$+-̊4`)QSj)'!h*x"|"_X-#]ђ>P˶ߠ%-'o_˸"\ђ?P&kN -ꤕTO *Y4W6dC>rl=hs 9{|㖽'&1#,p*d7)u܁O3-Q`u{Y[+ "";p[9!.I7X3 ɔ d9@vBs? u3e@yӃS.WJP>EuJWbhC821QqfA:c"~B'$63/14ـ;hʧP|@7Cw2V}7bHGN)FO}9~7]'-xWY)O0}S/R8غ>M>Z/*.~?oswKb^"ޱ;zū7QtC^0>o%TOՃͽo}jluPJ:l)Sl%puTM` P:RҤbe D K$L7j?85ߚ̢6nCM੡R}LRڌ@T¢ NC!݆^6pTCT͸@V\m+SjAu[S^n@%~Ҭ!\ -E<9񴟄srTz{JarT(m`<9NTT6?F{2q=\^қ̵"K2v6g[⯘I 3yjUqyJ%!qNl1MOX@I@M`w#Avp7> stream x}[e{c`[uNթ c<4plc%9(W&)KKIO//?/~??寿/o˧懯|O~_?bP~5/?Ƿߨ?oGvګ7>U޴M}>۷|L9Ssn{X;ow}vmc? ?jԹۦ7^˱Cxl[K>zsSx8r8PO/a^c{q{/걃ȟo~7/_L?_R =;<,?ݱWX5QEvۋ_~?|ǿ|/Z=V9+kTV?*^qf_OWZigw[ulNj}^q+ {8g7puܽzƺBᒿ~<;W/~АPCua]#<^?.G|gۡyя BZ/<|uaz_Y'PrJZU\ei74BwwE]VI?/5O]](";< Z!c~> >a5uԷ@ؾE''_؀˫vm|6g{H:ԛޮoj>Cv nš:fzMgzJ6k!aP6'(f۠HT@Yf 3)qVzrΪß3p,R'^s_Q'ٿ`oqʆRY*W/1FEkR뽻dciЌ~(se5Kv|p$_ؔc|ĜG_I7u4+^4wj=/f2θ4K DS+%1?ku'?hgk fnGN\IvuGt ?Kf0aI>AMdOꄰWzL%V޳IB"\c! eH]A10>l)&St2ރ:z:WDZXR{xL{vZ{Sϡ Ww")1#'2yp=z#ë=~#`.8Ѡ{sb* ,2 Y :PJ  xدIIWoD$I~g1StU{y}#rMT~r#Jz ĵ=svZuMV)@hhո+G.HE?ebN\oۈ{`g?NM 9oYz x+Ar&+e0d(qeBD$\c0wq3 h8<A$@ЄoaDko%h@V{.&JOuJiڶϣo[ ]]5Ky:uZ*Q_ aC²lM6ci #h%? s\C=^c3ڶ҃3B [X*؁[0L!` LQVª!Tp"sDIݷe8όYS-tߦ#L} Ԅ) TmmlK>Z/~I6WRl4R@*b X$B9]Yr #f <*$&fDq ]7Am ;0W+x x!uނU}fǶu Łui%]8zkk@oMW}zkw=OP@oMg]ЭQI0@o@ Y$[J|75#WYDZI\T:`Տ"i[tSb8%/OwC)VI2Q]~2_G#-~0b&k/W;nZ).ef({1of}qWC6[]} tƇՏNԠq}\?unCCs:$Z5˝#/8ݗoPڅ{(S'G>ᐞClpˉlӚpLPˀ4`߬?w;A{/mzZԩx5GVrk2k2׃zZ@@U0L@?a?y-; Hii;Z^k]MM[YhE,(GAasH \WPNĵtFYCF.7gs~NK1FD( )NDv.{@M0>:O)?;L| p9-j<<5FwQǛ=QF;j Q]$n%D|-kQ>j|ޒIrT )ķTtaM[ -ŐouM"&q i!+cǧ`>9_糋@ RPN"B3Eզ-ȦHDP@dϠVFDVN]a"lf`i@J-TZ8rbت,.Lєm"e.[F leb݅aeCPFЃmmD4,V#iWo jRPCF5RPBCOХ͆)L m 8zԺ84n%;*WiJjbpc(w~b5}BN%!t']~Ąڋ>@~[-߃3 nr&8@PsƏ."i kUl3q0f3@d=Y}VHlf gɘD]: ?c&4k  F-e ]`7'cis @9U=^؜)\؜@D؜ >9ARBgh 9APA@}9Aҁ =fs>JK01|&27Q#˄~E_ 5~^4)z^U=/C O qW57CA۪v%o݉=~8ay/[1uִpsx7;gﻵDN>Xo֟ó(a5qb#7дP@~oIV+Pq\(9>)ʆ92ؾ y iv oB*c=!p;8AAuʶ /!n'9^&Y&\NCZO;@|sit_B<aac0w! Ki  aA,#SZ0bTXMxqYҀ/q{.Ɓ@ABŒmEc/ALP(Ns#DT1|%r*ńdWL;e]ƲX:Xv]ncR( blvͧ( \l:qc@W&,ˀvgB^B(*--Tq5Q7!kyCoB5o,1db$ҵ.) 6邒<%DbzR"AH$z=#&e5wHAH$G=<1_KrO%(k L$`-foYc) Qd!(C]or R_=}yS9 B3Nsop~~i'8b>9컶ͫFݻOw}̕HNnѬƏpp0_Sjtr>T܅c4+)oO _{OYb<6srASB9b|~Ʋ w_Kq7=BfS6H[8 A) &G0/7)"¯/7w8M1[pi c\f+(\NNt7ܨ 2ܽXu@Bl@hw.' `7x0/7*8Lou!@[hH߈]QHpwl_nSe~y__nt{ίOu8,:ϽNs8@ \NΜrBgFe`~}>˯e@:\g @.#`8~t,g *Ǐ ~wNٖ8tyI! ,1l к!7" 様4׸ve`{ ܚɍF<lLm]vpWD%\]fPbl j2\1'p趠&#z5s )5{H¸RV˗ ̝MttGM /@0X^3# oQ)PD$B]ef(&nJ(]}$h(;5t xiLIەJ;{ps>p^Lƪ3icxݍG.aRּAzWJJwV>/ڜik?WLa6wgӶC6/qo|».N{8=?>Nv*G=axa~,ME"˥ EPet0lbDėr0L}o\6N1@ 8@ņy'͈JqĎ .(]jSɛR"XXL#A@  ]Aх#Ms}ưk/ rP$m)J!ܐԕpĆd;}&k7=\-bkՉ4&UE$PvJ{|[J\Qՙ4$J,Ex J@U! mCT0~rNƉcōoOXy"Q聁+8s(?uԗHq!'G<Om|shW\z? W t21  r-d2Ssܞ R&a\QK\ 2d\'ȵIA(rQS\ ~4{-C$U"'("5E訊 !Wkj M qd/#@fd*$J.1e I EkL"Zr5Fs&8&oGȩyN*xJ4+Bw架aSxܵwm65@w7㮛.]kk26%nۻ=%gͶ;l~}#CWJ^g9^/5s-6Y( S^@քePOĈE Mɼ^ Oc C^o)(F!eG80[lZPQd1 ,Edӄ(h"[1(Evo)eL\ AEY Oc Cl!'ȢSٽȊe(q)GE>}D4RPQQd'a"{Yٶ $"A ɦl=>"rr ]`DȦoa<ɲ #"бߒ]'s0ZD3U$M#T0|r$,M!95c;ţiwgΆfGd)gK]b3gIŔሱl> Z7"bb%1cφ+e_=M*삣ˮ%IK 2VR5FTXQMeIHd6S#PaQJ4!.zHŽT׀ ;Pl5 ;,JTؤKSa2VH,V`J2'Q PF)*٣^KTXyˢ =A=K*lVeZžNpTʋ)*Ui?<*.| kyh>T3> } xqzU:ގqrڿnԻl@GM~:a?3owSL.RsLR AiD:}[՞!Z&U"8(<eĬ0l\JqY) Yi_ Dv3R@4qL.(C@ч) ٘8cYD@"aw2bB@pL. Cх /z1,1w!^> XR@CuRRIܧOؚ"r8&`6f}R A9 {f(6=cY1ok~1hH$ QƮ6NPm uʶ޷@X֚Ұ+k)kUą!iX2? ʅ-6U#~B6ߏ:aWDMaQӄ 7fF W-Q#^{"%5AeījyMx#U?̏^.8qkJx\b?' B`+a9䇗 1emg{LHTwOtGy:nҔB;$(ΏBDq[:AĐDzn.@K!3ȧ?(6ߘ>eZFC"<JLp1'Pm2 Aґ 3w9'!GDTN<-PypvS?V&iK{*Nb+@]Y4ri?{[dY,kVYnU%. IMFhՄ* iwIHj2BhDF%R.&vIT%r`@VY$FʂR.%oMP@/A)$H`v$ ښp&TpBQ8 $4eB}W[@$lT%:^ZD"nog?:~zoZlizkkɡ| GTk)q>)Df,hR?B."Ɔ ?ZX 9z>Zƌi]t|>"r"$7}9/853e$v 1]D(KEHM.a{g R Dq&b2J}w^*'ۖ1n.c Qz,au)r{de;K&s\ߵVyNh(-<]ړ+VjJ/:U\a1> UAʳ'3UZB+k+Ŋ"XBPQ"+P Vj" Y$b*a`5hBd"j xiT\0X^3# SA(d(N @2kU0 aQ @v*! s9D!T QfE620<uxZX;ɠzDu| Zy\Pu MqAV^߭*0}]&ÉQة9r{+(0Eu\>GዢNTJT$XfN1bSS3@1o@؉,R-?KA9uJ'e)؟G?wʂu2tQ)hKcj'${1I B BNS>х)ڧ3-S,b!YTcb BBNAEDf(δOѰU.FFPBҗ39D hgNP(]{6^(p. G!Wˆ c 6-sqi2VCe+ƢqV)&%moe-s=Q^+j $\N$3aգM#3Ig[JC`u;G8j+er.|ɵM7zˎo(_ⲟ`4u Obm,MSEd;J~۽8x{О6g[-΍fy>yu#d!&&KDGSq sy,<%NgFѪE% j2JJ$HUԒZ&0=uLY꥔CK5Q!i[UKRY5Nhe )jGGUĽ%MXx2P$&2^Gسe(qeBD$3sƒs‚B 5l7FDޜ]ylV*zba"߸ wX C9q<"g,9x이Ԗ3}NdUSTPI5f _v`Ӂl6Pp\v(IœPv|": S0.L0m:mzF$-.#}Dk RDJ+"2|Kۅq!eK(6 Sfera)q{5Av1!|@4p\lz b˷U k|ZĪW)6!b#А> bC!(G!LjmdxwnTrqC4fA8CNpzwT05'8ekE}z > zf8Vu\GqvealuG1NcUSTe al>lḌQ S10_vO2hZ.c4a2)c,JZK)×1 $_(P-1r9)_Ԟ :e ɲ\X WuB1.&,(SƐ eee|!4OàQQK;g«NC-1@*e :e>uV[܆ y]ha뺌 ^weѬFU@?f^w 2F3gu7TXYAx]1aQqB ZWPG^w 1W)cx)cxQ[tUƀa\fP9nX䬩`~j7mC+1+1iϻMe12w=m(!)A#)2joD.Toux[@1b uTQE'9PDes  %֙4uK#0X^3# ;$D $Cqe um!M2-ʙwC (Z|'LYЧ4R{SV2vR>֝]l;Սqmf fD톼O,1;'>/[EcUk>S›*P;n/j J3;5}{FS : 2@Q_xfЉXf뱢uv-؟?tV7b Od{B*Cņ>E"PPMaX3V,w4Bb@4rr@G'"2>D6RN8V6.t3"R@qrr}0LZ\:{!Vȥ8B.F tXKA(llIg1A0Pxb4)+*<'ח#>Si^4{XBnX&:},tٶx0 % <]CPHT1|)r.||MY@zg9Md/xa q,l%s` jv@pWP  cbi#@w0g,38WO#:8rOOP Q]v&u*Z!T7t!@& fӯn|&'wuO*>˽^*ٕAww C*T# " ᯮXo loX]xC٩,xQZI3JHxd\C:+>L5s|ت v접4A76 zG zd'л&@E%5m2w&S HU*MzϢB#M'M^Tdcq)y3 $aD(@t A=J"#;8x9@\H1 hGc}ŎwX'dfEm]}0oJ=ǟi7OoJ?GmVT6e%=M響vS0U~_ED{||/O1 9wDXх7-f,~RpN3阖Gvm(sq`Q'£|fj] ʩK ̙:h~˯Ȟ2o;Q06t5UL4H|;&H{)wvCt63ڕR+(酜8qS<ԉ[~e^ A,+ !`|#+((腜XXh=9q~˷JnBݖb4d^ QG>'o)m |Etڢn‡z0[8BK7;CNc-}%tLSlU,,9}gh;Zȏvin}qv3mb%> stream x[. ?|FZ9 cѢA]FN`迯4$5 Hy|oӯ˗??_~o??ۯ_/O?=>7?~ا?}}2a֧u7~o1Oo ͛{ kƿ͚f̺gO?oyO̅<|;پu.ey[ sE>'6~{,KSsL~0/lOq=~iݖd+_~O? |o?ݞ=px,?GkfsqG-ɠyz0UbKH^<V/,OBeCZ=&oN!@&j-lmG2z뗶;w(_kxxRKxC^Ug] û 7=o4Qktui2B)eKŦ]LP995ﱴ;(#\|9>eOQ}[0o+%nm*Xo8TXLl5?/ZS( ٹiZTPjT'^a'n]5U, Ő_\?`BfDX{a_й5lNceb?R%tVUsw'Kw7YrMGmѲM|jPvo;%M"4o?X#^K^}r[nQ3>Um96RAU^ t]|6î?Zx5Qʖ˖zQ`x"{B%=uq+ea L58u֣ AJ^s%Pz^CZΕՐdV#9¤/:cpǧ, "SQNtmMuOSҀ]B)FN!u 4)'Sj ܰ$'nNԧpNL! oB`\zZA΁TOuqb꫑m:Sfzsgs"~y[W.7Sk1hU)^ԧBUoeP g E߸>oQ,0T(S1z~zمTi~Q;mt9jB+`M΄pL[tesrrFFĂui g&"5>=uaA2H}KG] 1ۣSR7ȽuF^ICG8wY&EǺ}iM q@S)X]"qJxtBT&XB"U\s ;eC2WF Kϱ5>dמRLOp߉PF&m:f wc_O/f01~SAh;W5=b@=0D0=Jaq-F!D,Vs - ZYط呪ЬOmN 7 k{Z ^X+5[m⅍HA#) D֨1X57 Lm6NBDSp!W=j YAJE]2~ʃ4MR{{=\;$A5Z_:kR*~i>m\-5R$Q3Qދ8 wqM͹i!",F\ WliV`+PlT|^3*l$.k|IAY $_T|_K ʪq] I>(|EMK$I14F+*hfDk:p"$fG/׺cHש*r=j"1E2@ 'lE97[_T2Ֆ~._(Tm{v¾amgQSvcI>cKOP6MW[.cd}=(\{ L*)NIj'TX%n{x} _Zx@ QLo Rr Pmε`0YT Yv]/k.ÊxC *f ڵj۽v)]s+[A8xfŸ"& YWj䴰o SXh9DŽ] ݋z(d D]%GqPnjԨ҂-3piMeҽTxTJ@ii goj' VC P3f=Kb=#v,5rZH23kwڤUY0W;u/ /7'$HrU y/M@@3jv/kAW}Kİ"VCFۀ15[q>s7>ʐ[ᶦ;['77IAY! 2{{&)(+hu D" {St{+ٛ?4Fdo bogF@" {+:_,}a)P8"h'V2]戻*q=eʦ qV(tpFZR$ᱦC{Y>AOx:&~|.f 803HYE2gPw$ gz/M{4̽N Hܲ'ۨ8,r8hUbYhb˱]%Ca/g, N)))%x;ij95&"8g sV "uD]&pBPG9ۏ6[% o)fS]݊Zҧ#2}BJ4J~4i*1=ݡJ0?C,sR3ˑ;/' s*]@Ĉ#x3rj95ILnԝOP7j4an B]H݄B&$\"JLy zf]2/ŮNg/[.ԇX{o=e~S6۬τe y| $&ĔXrhϐURjI$m)fӎChrұpe] /+MTPAl2gq]l4HHMUB h4٪M Edv8QܵX6u :&\G9D0ceDx+N!6wWCZNxM^5lD1rZ' jV%lnClq_?uE8|15>iGW7yϟ YFkwdh64٘Q^y![zy=m y c=.r=lrjtDsQ̱=gJgߝvpO,.155{$~1&u$_f|Rh {)Ю1w/х9T-sVx%%g@ƴSߟDxsS5{qrVݼ@#S2ntA=݁г~̑P6;J&&]aZN|w)ǜ-U-o}x~o?a*?v$ >UD@çTsߟS= ȜTV P,@1p;ik1=qW4?G^U /kW?㯚]-~?JќSTbJMC.AobsU5@[QObE&'=ij15W?c]݋xw#.81ICW)y2^UWS89ᔌ[Ӄw- cv+iWZ$&2(rxtGSCuŞe1G]5*x~=:a{ʏ H'S)Nl1\2j𭰷\1nbM 9ޜ3bm+؞#mU cη.fP@A@_5< YA@>A_$>|TMT,@eTFC]`t#mNf8zxO^=B|rq}l{Dp4dsY mɏT ̋`̗vg ,&u~1W&t hVtjFѝS0he`fA7 90=(GE9tYfPu(G rq͵GC1tYfP̽maXs":BwΠA)a܌[R)W\ Bz:rvs3 dc@j!7ׁp?VLu 24*Fjg@~2m@\8c&U4S{!Κ;!ku/v-#aZ L n $hvp3fW~@J ASS-f=HP ASS-$$TjR*HhBpFH #U'S@@*k"HiR*H85) szP-XeՏ,q d\dj2'UPhałyx 4Oh@’}Bt A5 @}BOmA.h7 ^ }B;XzK4 >O/O~Y;b~-lȓ] aj9Y0~^L Tby 4K+?,ᄋ|~?_ORzoj < nXH5r4$2|sttuoKR1(Mb<oaT&}%?wꤜ$-q#X”2ЮFZN/_ Se |9CJ W慍Xr` əЬFZN@zm1nqwa39OM1?$sH^u;kw)S)p;A8z=_3?n!2ȯs׾ R2qg~ij;ZfW\T4J R9Znȳ+Y]""XhW%́y4|`K^T);3c<*r]"G"+Hb>v&hsv4V:x?2 u411G jOKIWCGVMb! n6 7bzk S,j9az9~ȳQYnVLVa~Rì˴pHus߁&8 Jj-'ʜ`XT,?42>T|9!o]BT E+hDhgVkMչ|}HEpfmcTi*m7 (e2QG8} &S<2MB[df1z.?|]~ 4}ⱓwl`U7yzg?;_~M7\~헖:/`l]~@CsDh^~fh`dnݕ3]qZN}VC.-?fA-?8}smD |(?,fa[L۩ZLo ]FP-?`-?DfA5,?\b RN\[GeiW)?$P'T2ЮC-I.-?DfA-? |3 YZN|L-?DfA3-?\\~ì[ ^X~+ +iű%?0mn~ qU}Dm,?,?;j_~ٕ ]+/?,L,?h~A˖vLg>x0e>ujaaf[_~,{$"ˌ {,VP-_~(=,?L?X'F5`V"ML֙}Q+0.&V_vP+T  m.?bzt`~na.?hv+!ڼ-wX!H乗l緰{I7vO310sW*r[R塸,n>ޒjV/&{} -|~[%nY.ѬqL䙯l;ׄ`ً6ÄCjS]4bFY-?2V~O?4$"AgJR̔}6zc/ly΅IMV(z6?궤i- qM#U5?rs>u!?r$'Mї*HDsk/tG/^ƻSj`;/<fiƞ:lt`OPp^OcŘ!ݽ/"XnLͼWlz#B(6R!8g3U xV'WMbZdj1.̗]=XKCL~w/ FG.nDYI j"҇Bsb݁ $#Ri}YLXn5YӵH{nlo& DZ1wӚ^s[3i 1 A r胼j?~PDk(}^g[PE1̧5&B%LJM鴆;n]><\ZN6Wu9G>V%7cGdnҺP$mۆP-u`zrv~i9O.<@S{.s}90LԄ{xGjpQRo${+TUx_rn! '(EUy+J4a 3H:(a=%Y^Z7|׏ό3"B+"G>⢈`{j:eFBGx۪qeشcUP2=R9No}2' c.ۨK 9n3)?kv.Ui.ݼ0x0Ձ?sfC?Dn0\>nLU}YNP-ڲl_rȃ3.eaLe-&e+vǍsɧh'o1~jpTIyG8껳thWHb+LE&,ϙDڸ62lep\א)^\nSeWN8S̳GBC36.3:wa-{|Ì<\ :wLX/_;W#}pS}|ޭˤnͿxC*'&Q`8HKLhb.=&Trũ: Hc41R!o#M˱?UNxP@GRkNcĩ2"sP5bm2M}9RM5 ΁wZhBT[W+hve#fw Ѻ݄ qr!*ة"=fWSݙLI=FKRSMJ~Z![!Yn L\Y|snIthmk6D}W)2ܯH(í T3K&f~klޥ]ًZ(Az0)Vvae ٥yG,On9L\405ͭXشQ4!ݬVjGdemfhfX+쀝ۧ{gvnF( '|jp,n>L碽N4MWٓ:@y@"\7{81Hpt_*Vܼ pAnГJc Bp ,Gg'6nk|s;]QnC{at./ԿzIGsQn\IyPEcԭDYmkDh{'m u5Be?+C3MDN & uN2!UU8FL[9F &L[!ݪNz/h2zZ![M1Ž󺸸`uPkC=f)Z0*p@>?)7_&l.TA;@z ;EsoрyL=di'z{Maf^ݺ!PXlHdf/? phinL86vJ}G`{nKxXLnߞB(pjG%.5-I54_ƎL}.%k&'`UzE7xjʓY`NVV:˙t<Yd`"Yڽ:LGN:R^ pX(t;4T +f[bFnN튡xD. X86w^&*19j$G DƖu2N&N"+lm3fpM4:n:h IWE UhRqH ppSqJMud܄tܤ; 5V"&ϣH.$#P$r:!L@v 01w>D]ĨDy8%D7~h6O6MT8l+x쪐#Py!a%6Kp~>=ď%ܘl;nE*д"3jb[qJ齙nGMFv_H \ FP.0kS# 4kgMsU+?#k֨D4 Tet;q2`~K@* uUÙZN-n'7fÿ]\bKQ/EByF)i0wj"nք|E* BT6JUD"fL4@enj2g~ct]^躐vb1R_@ZɩYv&"ͮN 40 n\#Μ)ZB)As9۩QC Y[BNe\ˑ&{ylHz%=bNnUF95*Cڙ#̑^x35i3ӊg4 Nؽ~SH4nԺ6;W4(򤛥%Oݣ&SKttUPQhRw`RqJ٬S7Oޭ:SPaV"Iՙ2̎<Ke*n!Ӓ6QJg9a9֘D$SitF#86lB:"k%k*kUG2z!km ]Pїh endstream endobj 351 0 obj <> stream x][eq~? vBB 6QȃPd,1շ[3]VUuu}՗>|͇>|__ӧr/>?¹:-9q߾⛏DTwN%[q5h{%gf>ıFe)wzG^; 1-VeIG*΂X}?)jn)f増InNJՊ6yON*B̋$؋Dh<)OE"8rҁϿ?~ח^~ǿa>3 KzBx$^w6Vl^z?QW@_Bxr2L7d'vB ;Y $3Rp}b'^<)&2 *i "F)? >Y" ǔCH}*i`*љgwC:?QGq?[7EqJ hA)U0qPN2E'6"!R#9JYw<0"DCAPsAֱ/l ܋b1F~-bB?MXgbD S'Aa|D-ȅj˥)i ÊMd~D%gm5Evem/NN7iO..iڇ5iJ&;ge2'\q/x3R9L ?w*}\BW: [2M:BKHҕNvYD_$aʱi~NdtPЇ]_MYCa30(=ɓډR,*=+"Zł}N>@`$)M$D™6UpLDlPoʊsCę  WJ ՎMZGӱ<:_Gg$"WM]Y:Tc+R>t$xJFJ(iQ"$R2 \z0KbqiZQC` @mZ={_(+%77p~Zlg.L›1gA% LZ/|DžgVlJe ;*X<<@C%yP|*E <îK2ؒ9 :UBAU1 `ng\@sm^}TxI͖ȑTE6qTDc GUL"@LΗ|dgy9j6KlT ltS1(H~_=B_IoPs5J+ʥj6klI liUQ(T~cK V~eXyW)fVp9 VvZAR*`b=*眨@qˁ@ˣUh8@U3* ]}Μ@XY%0BVכ/AGN4Tב-RLf18(}Q௃d 1hJjc\U*ضTSV;~wZnkkܔbbcmʡz<9;Lo+MIZLuZl iz}S=ssyL@v5@~1պ':SuS`˽cgA(V vUͪ3Gpf ) R7:%ňܺaN.6{ynKrASaWdg%:n4pYwJiࣀO)!4&̞X-b]<tuHF}s%5%T6@>K#r+4oF~y\ 7~*0rW65Mk?n+lְR\ ǍVy%y̫l`6Qlj']E⭙,Mo hyiCn6v>T8O?|;hhl*ZϹVewT;wPdDPA:zQ(;HRIX4qJغHu*YQVwp(eLGmzl@{SD JADzwPAqNϸ$A TD>zd$ia" 4A:dVF)+DYX,]0TX`O/6UFdLsqJNb{8`YӍqpv6h[o˻xZ\& Iz焳{_aQD|10M y@ [pB]!?_D\bW=|N]!dqdGhaήbs>Y -9lCuf;:k2dLe^߈RP~EfW k$FM'O+Pnj%7 w2i.ơ%]F莜:'A]ʗ.e[E)1O|c.۲ 5W&WCn;4un5>97AA2T< & \_+8=*j 9ʱ-9C+v#wA@e9=A`kږ90۵Nm ɓD}>v[quU=Tb/Rޤ\)Ōؐ32Ƞ LHGY ge5OJq}l/[>NVBۑ[̧8l3&pҙ +xf>?]f^{SwdlI/[^ǟؗFZ3ﳁ*] I:L9AL#Bܼ r@-#$jr(W sRy(xCnոVI8k g+P◪NyrϖϫW;:w"%$*i(*zA52C#%hX"Z`?F92c0g}:#_nxUƨv'Mߦ! !B9,~H=h{xmm 4#fUbb!j|@"ņ{Ȅˮo0| UiG=vR=oD˱L߳B\kBb)<ʑ#:v|N0RoVßD6EVeQ3Q¿ qaC%a,绸;e(bml!-z1}'=t>߲'$/z+0=< ߰W[׋r ]ej"@؃W04:t+D|Gts$H- "*2 Cx*#> OL 9"DMҏ Ggq Ƀs?<4SaN9H7-"AIȺP~{l Qb;c#>`OJi2ѿ^e M '̬P;e⶷ l$TlH/SQAu &<$ c#h=RhcVVZGy_⃡uL QF:e, A8 9QV3K s[kQ$G4‡ x&IVdhi1Y;_^>VgzUޥy7;܍n%a3b>lzoRvWuesJލCTȧsU\d+y/Jgdh]Vp^Qjo-EV77ׅ[Rj͟U-yUm+&l s8`ytJԱ2ovAx}<&X4Ob" QgףqD7X~3yG?gyy'iX'X>'6H_5,˟si`3X>Oc#<_הmˏ_l,P*˧'̬;u7$XH)?b#2YW*ʣTTGGؤEX5GyD꒑X5ep8SFzcg$*7v毗'z>U0!8Ԅ ȺPwp“u{aSFEŎSrgUfUš^ 3mbG([a"mUYE3F|Z%`@(7ZySMq0DŹ S$-ddADDkf;&g;.}s2y;KKjgIr幊Mlģ5P>|n~5;8t8tY5Τ~<݋揪< t&>%hp( $X]hGI~BêFLEg5`lↁΦ^m{p7znjO`y9:jN[ã_t ?e|?sJXot58 C@-ك~lp}rusԕ \]/Db;K<>ti-oKzD"8v@rv[셧|_ R:=ʑr06i#]P%C'4Q̨NwC.Yeȇ]eX^$^? :%1b^S5 $r7ʈL,']-4.cyØ} jH#r,X4"L fʂ1 qN%Qzʩ>V Uŗ8 ÏU-\I*ⅨFIJ3"{LiJJa/ @UnAˬTYJJ\I@/p%n|yOG˾'WW8^pm ǗTGw|"c >X=nQ"j>9~Իw_oL4ꌊFeVU,ɰe:InaG+KA?G)>…pq n^a& Bkۃ \ʧQ'|P4|^pmh'CPV#Ï*,<1IXPſVHuǡS}&W`_\Chw&2wx2y,MiB?PlӍ\ 8Wosq Cy=Kh&֖uם|%TS?EESoEQlAoTE ,sEjd6=IS;2n Fsoƀlaȑˍ ~Tũ=M U'I~BgB/w}9]Iv6*)y-.cy/ [BKc{#!_~mcTQdq|wր7g8}޼+Km鈁EnMCO(EgwīS~ϗ\Qfx4ɚs(V*3/qU8b³9N̏X^))>^EʑS^αC9^q!]PPYܛ%v9[F$1xRśpΛ1SU~UOKzj3@vn>9+Gz'Ff.sggv1?,1gNaw2i 9)A:799_~P=(.VzpÜ/g|&)*a_88S1w^q+S p Y"|Q) _,UԇYU xA"BP#P)ιBq,m(e\ F~xBZT4'5MvxsQ!57 5Wé+⇄lO.*"uC:_x: 4t*xAz 4>>Jqi 8eQ Lm}e'#[ݽ~XLZ/ ZZe>V~^/#aMn7]mKNOMVtdUZ…~7@T  D8t6 DWyq«XW Ve7WJ4Z$bFkQiĩ,wVX:.wEG[YM(؉z;e-)qMC*4^-ZݱUK+mXuֲEp.L 0/gaɹepfCqR$p|Mj>;8ZTR/2whU}T:ڦJw|A7}?/ΘYsՐѫ>?q[9XS4gEzDcMzq}<-V#:A|!E<&&1&?XpՕO6EK-6׊RhͯLVPs<6>^[/^C,8RY\2GFecO˳'gpRecy.ܬ iVrUuԼbM,a;MmYT|랫$:Ȼ ƬC׎J ƅpK6}&_pl!F }p*N4oyu~p~}.<'TC6sſBr,T[X E._!.KN*Vdb^ g=;$a'زX  J3U,!>{r&:b9NبLʜ_>[4nrm|.t8ЈшXlЈ55n9v= iCNǧl8h` <ƚ.o>2WcQ,}|.2N ]q[$l4bZq ;!JŧxIj0$^b=|To#JA}iheߜX]wI.6OZk&d endstream endobj 352 0 obj <> stream x}],YxGRw x\^'ؓbJ%ROJ]A],")J(>_Ͽ_>t~?ˏ~~ǟ_÷|zß_Hi^ƮR\~۷߰_?)ku:-|;vg7o^T'*qJԹ?>;?w5Zeeպgnmpfo^1T1-՘RK߃M>+ c7}U┸2q/~+O뫸Xg.ʩvaWI/~o<~4po(&4j56VYjfF]˧??F6W.Vo 1M?rd_H#%{ń/9яq,ao{|ğfl{QhTG|Z>@QW3sJ],$x)Z5-U{HGiՌr/Cf}/TsY3=JIZr{r|o|>L5W+IB.DW&3{׶1\(L>0".27}Oб{W=c?wH ɢ;;!h.~i⣇&Lɫtu, %O}/vv MZ T'>i{)ni9.4瓨b&80;}g!z\Gƛd{]qL޴?MúQ5HiY=T`>5pWeKcg-w:)宮9 >;\svGrdtoa#l`ZR2iܞ}xhc}.9&(ήtl|dCP'w#ȏR&Vټ:LL! {v0:Na[îN}zh/F+W?SI??4i~SՈ@Twϙx:?dq&Z耩G -;ŏwZwቩq /م: w4ӾS )nŚY Ө"7{6,b!,|2 -v>q Sz!uӾ6_qѾR\]8}TRooyf/ӦMjMa4I x駆>Iaڸ;yi̙6 [W%ob]'ܩ|_wΊQhi ŸvOwXpI:C< gN nxTaR>#0|w34STxj^JX;LN^ Wx[JQeb]\A%}VCiPϜg9u{Q6ł@U,BG[Bڒ ,{,y)MRJ@; &A=-&D3Bݥ!&uZ-kȇ{8Las~Lxd{ ekO(SL5*dh-a!;*,xtU9! cฏ)=BH0s$DhɣۗEj4Dm8D4m8bX::x?69q90* FD?ɜ=:2ftj^z%s,sX߉rɎ-';Ȗ"ɜ85晘q iX"0E W4 ~dӡdL RO%,I(dN CMeU$T7/{y{x@|Պ 'vPЀ#hhLоQЀH )QY'mԖ vrvL`B4X܁/`n>yp&](MV 6 ͊Wa%'n]2f+ʃ;C6hJ*[Pf3NwXC wZWs-ӷ5O3Va@`>2%yW^Y[>m,X1z%(䬪3M x%F}e̵PMֈY[=5:y'tZ3ח|rtxD; (v ONyFlOMazww#hFk# u@0Y 04׸1:@cv&0G#  H@ȁxJr:1BsJ$i,tL)(&SJ0ɶaL6l7"aGچq8a?!L}2%Ц\$6z=}C*6@ꊖEgbr%Mi[ __+ f67j 6>{,@0 A›F0-H]k/xW:?Ug͟HDLncM;g7cM|^a_-{ŎOb[Wl Tו]N{СAK6w1u\xMY6]vPgH!=<>`u3j~ʄIIb]Cg~->2ҭgelEP[;ڧ )>u']b 4.<ܯ2 L̶Gy4Tg gC& H`H5(܈34t0f:Q͆2u7&) ^$ ^M>\RvM*ߑ\UXO[*V-3{0r :KM:"~ !hpE I HSӢF_PN-!?A~:]i߄uS.i#qNN鋙N/+U+!H) 15ƅx`d6B-+8W0V*8 G wlkW-+CK 8<oS, k.,BB#]iwCZ'l)(Wl"V `TDW.`t&ݙMH{.% ~|Bp֮ ;+2iê:c"V]( Ԥ6d[:PPOga}ܖf8$pA{YLv,Ҷԕea\WJ缲Szb^l^0a^0@E&G`YUI"B_I"$IF"}.o 8]zqd{$^A<Fo*͔XJ>]|RY{K7 A  l{uvToqMth7̾X):4-ZܜN!FA%+ࡖ B*?DQB4%@ʋcnp0=> ʓKף\R+)0JQXV yEv.v [=|G 7$Vw[`yD_CZ52.)遼 KD%&}Ëd֜F/ q&(ҁI;NRHžT+@8? v{A4D` e @er0M˽!i}[aoP.dMIۨiQjΎWg_UnNlWo  &BH5 |VC;aG__Љ4'ɇ7 EsG"$`i-Hihrm/ї$`GX&6OkhPեcR,V"f௻P= -6.*np: m9}kfK : nZ6 LJPW8߹3xuCS[^A51)>΄=J*٪Z<խs 8r%*;apԴ8p/u[ զtʹQՄ1P0O\UW`iX`M]=g G='q0M3%!e}SՃQ%lj0):zx@6 s=J>+-J \$$"T.BV+V- 2 `h^BQo$+D"&<"Hu -3h."`8.#,4MeclHҀ}HBeQt Bb7ģe*,[1!@,5Ohb{؃m}6gWj.-j)և!$pqy"RD8f ]J20SˠZE hc|քL;axvRt)ϕcs1RY>b|>cIcѡ:ѱC;G)˃аf{.f'3gօgus*:\LqP]qH1DAQ1UƖ%p9Mg[봱eo+`f\1D=#hv! ,);L7w]sKT5C/­aB=βSS2R`C]Jfp v6Ӣ;Amk'#u >" hs=EŶ+rTl9ǫ@UTl VYM3q:jIBь"^ +SVmnp TEŶͫ0hwc`ޭ;گGMYcS4hEC@sBDž[|Nn#B:, RfsKM¬.?ǣIjnh .S)}_W3q]e2 /SGlJħ])e2fXW-QQZa8( @XB{POsB5$9KJlK>eYzŰJ+I@9fde}įc9KcB1ޕ=ved˴;eZ9KZ߅>Ci}/v˴!e.귂~e.)~iA1Vv~t_8;6 "=mztj@@j3.DZfF#ƸVΞv+$ Z A$\ne9+D~QH˶aw~붅"mAGd/_Z9K%W!:_,ٜ]Qb'b)牺(+{zEhaQv#•lAIQ%('E(Kni5uy|, # [EG]-Or(6b#c3::.r, r,!8Qa8r,__Lv.8uVW;@3 |=ą"lAIGF]c tNݹ7j( mӑV@C/h~9BL._ɺ\J٩Rr;wF f^Hʺ* zUA9kI%m .N٩{ I SfTi:Ue y4 PGIBU]#դXU׃հ:aGW]iV@(xp2s@4Te^\Ð|IGfʋ?t? C6v|TQb)y+`P@J:€闅e:] \O; sȗI kBkʞW5]b[2(]rb;Hn\WlL)5?COF0r(C 6o t06z u>KJ.z@.&ǾkWnJ@U4)< f2X}vJ/%=d_{DRoUCC߈MFތp6M*?8,í%/)sOpk4;8St)l suYU': c$.T1RMʏY~i탉a֫A{Q#O~.vv)ϴ|5rk d7iVUdW/!Yg.҆ϏZzʗ+3}xbqLű訞M< +K:7sr:W|SU|6Wϥ#\p0_u..ЮsV} kzi1sce}tXseX0WJK+>~M:a:>i!yJ=.4,°+SeW$-jJW;|" Sse-ssHiq4!XDXR$ B&JOXIݤRZOOR3w3Ub} :W/x3a̜HӸ"k8ኂ\ACZ*-qP]DS]d endstream endobj 353 0 obj <> stream x]]%p.%>ϖ\v!a/L.L6"q UR~ 83sJ*ӿ~Ϸo?߷|?ǟǿ?ןwח?}y?7'oZownnwn'qKϿ÷Wiռ8~۫VW/_ē~LTcΘmil_W2h]6vw4OF)4V' =A[zӳ\Vn.gk񹧅N$ߥZ<+6Y:[pWޙ ށO*~%{c6Uߍ%0ӡ=0不1Ѓ vuS[ew A}k6arB7-<\?Z+bQ Ó1:X'!/Kv5?Z0rT#hm\DeկsI !d/bM$82܋8iMiF7M*V DutDg)Gu{}o۔!rr~+u'FӖ&m:UMF)&duPxU#ت#O 3$C*)(g ;0YMUPEEK'Y JWM[{z5(CH9 (/G >ŸO8*LI Ԙ\]7An!dߨl~Ko"O*{C~~e [P_uJQ1'Ρv > LZowv'GR"A!=PjÿkڴapP џ! D٫+ENֲ!Pinh^xzf٥q>S,=l?GW8=Zۆ?ң`q.:D=viG)@}e@ Ծ JpWS*w]}| ٟk?u $?.eJ)(% /ejxq$ 0 d%]Ai|z0x" 1 k&4^nwA<ݿAo 9|g\0zDg{"ܒx|Uݘħ'Yw3`ĤZOS~x 1x~ 'D `opkhL Z+b$ohP֙EeB T2c'D2> ̓S%x_J^e8M00͇aMV==b[͗Iy-Aw#& ~̟:z̚>;&) mGW}5kOH`nmG&[ԛl60wa{Y?b}¸03v66n 0`fnȫ'ׯmP&Pj6{2V׬uMGfJ Wf Eζ~[6.suM uz`Y}ͷ)C}$yX =^~ĸAHc2>`\u0?bSez5z㩯^< C)*/VfJ?R)83)< m" Z"a,$ja{De_` #V ~5WjcWʡ<2ñ[gP:= 9i&vJ !zWvcU; 3; T2̼͝\C+Qd!%l N;;R$'r''АغͿ5TEj JEzWJ$ @֤?-!k7tR(@MNFd))%1҃^Kdm]Nޞhs&O dkTy"0ALm'*s™9IOR'R Blt<jry3`53;s. :g \Z qS$hS taO7%m¹2q ĞVNR1[}~W[g0O\Z25af&,;_3q՝kEed@r]ԝ5MG#7bc$q5sOs/e )VʚBR3ܕpEZД=TAE ڴ85B`&:WC)dPUuH)v~!K>dq{)JM%6aT7c0T1O69%KB>j@)ˣuɶl^qvHB[U)ֺB_W荕δbKrf}5 ƔzQDdjU=ӮMQrWK ~ U j@WRX@ePv5 ݪvw߇]XLA^=7)Z\vZ XqE?p)=@/4ugJnx%@mO73A/2Y,>\2˹⻌3sGY@Ƞ L4ޕ7N]b^Y>ŭd(}p6V%֛qmP],ICHH_m?BK[ˬaT{Fΐ7Kmdûӣ`֍Z8KVlM;co¹jЯq"fAD#?ة/4᪠n `r74VffӮŏ, ;X{{msWn`ALϷ=>hAsݴم^OE|~̗ dlHu6jE|ݛ|6)U9{҂jz@Ƀᖽ}Od;x\B| 蝢 Qjqf ,쁜C36=&RB29jEw(0- HC!P2{ slY25ȗ @(թ&Rj0v-iʸl-|8=N ڵN7g`ԋY 46w`pq,k-ȗ9Wq$y៞M<;)-?emߔXWg"JKߛȂx$;jUM8#JdRaX^.5aȽ#t=|MhK|X0+MjmT,;s:3YVq fEWGE:Й杯 L]l rMH\|>1HxێԏE u"|2rDjø, Ljf8߆ni9s]hC`ĜPkրМYJF2Tx?P> /[DsҺ5IФPC$ O\6UnTVE1L'cw'w'B = t+0]WKSyY.My׌QҔmJUy $MGw ?>98dշ?s`,d)!,L(/%){6yL 7S\4 P\Z#fFX ޲c`{_ t/S7t+d)8 ժ֊XCUv,%3hU/t%\+|Wލ))E(k)GA*BTSm M)F;TTz1 +桔S2F(Du4qӱwץOP@5$RYlpلh#k0!=bNfaV͔|1U/q|6s{z8oN{/&P/«'l'#kfCUK_%%Ēcm((nYm]>M[6WEl'_!ޟwzsSP`Z+pa9`p_#m{pTv r{SC :D y; H\܋ʹ"/EOΏx38h(? r冐Ae)gئaS0xzwӻC4Ĭ>IѮi X>3q oGAyXDY ** <SP\¥"V&H e'cg9ٖރt;`u!0{-.HC]PUU r=R |_esTBj0N9OJٵttgTyt e@m )kӁ1D&qG7mW7Z z kHub`)|K< %ά,2+ӓs/uG$Nf]Hk:^61 g&wݓ6iHCڳZ̑Ӎ*X L-CƟT9#wڼ~q2LwgNI"sJgjNjӐy/.ThU|A%s @ /nBs x,)0םj?LP$$n|Iu mvnݸfNoVGi_sӗ,f"nV5zY$,nQ[;9Gf n\|66֊[yî&fs bPif3hM2<5T4=b5ohF`5(7&ü>nOv Jߦ:!$>)d= ARDiN܈(e8-KldFLYgdINFƨn6; 3IF,] J^lsӍ"@gV5z%}@g2jXݔx#:3n42U;~\Cykʹc & yhSHp%FI4(b ~@02ҌLYsDz=4ڮ/VT2/s,2s%$%T^uPyCeHE@f(E""/sFeY`dYaeZ!2(@e@ijIV^Tf۔,㹦o?to&UXU _t Lc8#iԦ_ao˯ѳFfARi /+B}\P░"[ d/6]ĺYYIWVfe15tE;n#F| 2~trox&*ݍ"[7#;e%Gx`M8yR\X9BMbssY &Ѫё%9KOM@O Y`j 8f X",ͱ$e\›6gr-kf2s endstream endobj 354 0 obj <> stream x][Ƒ~0R`Q]}o@00s` *ȃk{;1,o7Kue, XU"Kۗˇ_|˧/_~oOׯ޿\>\.ɍ2dc_O?~;RvcD;ܙOeȕo~_=[Q8Z\nL>o7z/mͣVK)]ʉQW_w .U]bn75UL0IY*vT;# aEszׯ/xBlp7s!:H~W߽~uy_|8l]c+?1buI ^ũ_O6M~fMxhu|g 0fxvy]M}~*q^Ǖiw: b܀Vn2 :5|l%bDPBMkf4l"578SI_hm;jCz#/[ oq/_s^,5r<6.n`劓%"u* $YmInn6&ԦIp4oN_ݜ Za Ǜb`l)W>Ըsȝ7Vq2O\\XPQ8tGe(J__jG`9o6 1I P蘁P,1p8Nm~#!?IlhrP q)đ(1KL1'HvsZ'+yd0C_ G1_ g] YAYIs)#2MrFe4#AcAQg41!U.o~_mQ[4r3_g9Occ!cmk2Iir}OQيnA*D3^oK=ӻE=9 [iubd~0MOUTp8dd JdtMT7B٠ħ\`ҠOTMEyBp\2:Mo}4]Ts~eObGߓ?{i¬eٓ8I F}7>0Mqmi9/&SNz <1rgYxbOרݗ1`}I4+{+VR"txβxbLlDa~:.pj* i15AM|ܻQ`Y55!3Ё*F5.|&KnZO J7~; {AVfF} g<+:;`a8p;T@H kN@kذZ>{,aS$*hb?VCe gEhv*R}q<}ܿphVF@zK ʑ"nH#'q@5̕* P(& 2L"TZ'MPi 1-Tk3?Ϋ: "i\vg5Vk@#iWP?kpgCzHg4-5ԙU@ݙ˪ې™K'xX?mgPMoB'U`ID9tQ߁`V|UP|]'u,(bRW+j}4v tǵ4? 4zdA&x%OOۅ=hޮvᝢcGO1PM H :$ 'q iJP[ V 2 D %(/t3JP^Np2YYTZH/2!Yuwi/<wtwJ1&F9uPUV^2{6Zཬ+ өlxtPLB=& +$GVP>Zq+vJu{c52o(kf3YH77n&qI\)DչC7}aO+dɭ'.fɖ+D&=O:x>}7Mؤup8aD.xCMI~='b^&ċm1ҏRz[v k ֫GfNPP{1I7*E[m{^+g*- bt'5;(zn̊';s/6%dIUq]wA4}1v+xY$8K$-/f>?SgYZ^ly3Z^lybensJ{u7//-@ƒ:TkU{z;vOg#d|m .oymkOv/>ؗ5+N>X/Xc}W>|dۨS?I6.)Bt%$AG؄;A˭+$мyBl7w ee~WYw^J$9~z~*]̥~*]XE^)k}ja j͞]T)%ltVu0Dʋx &w.Pt\vgr$$#4suuT;tu@S[q57za0%)r5/NȽ%XþVvξx-Tk n PSMEΘG'k*"T5fbS(XeME^aq7oLN%fi F|ySG9zz4-TjY*S!N̏zPj~HϏyɨ_UWt CLnj#SeW8XV,c ̅!X/06!>XA ոJ҉]|'bh)ցbbHN0o|/,I^\u:xBչOG wtG7R%ustu招3j( 2>!;ov3)s_,1\5ju]+1P7Pt!_M2$ ؤ>Ct {J LSC~d'HJϨv=cpY`8J4+c+_ v0(GsLag ZN(7Jg.a';%bo,aն0i[SJ؆iE[_[GM\l pǀW |joOj#e2~| &JjqYHWh.L`cc;{Q3MSl"n5ޙہ Ͷƞ\J^X).M^4@󇰛ɓ%uV⻩DuVKSA_FxO2×W\ĥs՗?ifUSjW4?sDIfgfZł̌qٝwk;VB o^|셆+5{फcWTl+NTWˣ3W/b]{!"|9Z8xzYgsh'6I<k$,zMהqI}yq}^)3رaIn&hh& Ʉ3qT8%V? endstream endobj 355 0 obj <> stream x][~0Qw6C\1v >yPK d7w9->TWY$"˧?r曷痗??N߿}嗿}||?}ӗޝ.dN|8W 'mϯ_OϷ_} Fn⪥ puDq#+!\əvz߯_=YQ8VB-\`oy}XKBEo8 bM>[VzbRbD_]! 1$\;-~w ;U*s"I~Wyc˗/?c6 34tBl[IDE/ڞHۺ)xzgwO"̲'؞f*4Qhl͸uYiBd*z2 ϩEQu.kn~KC?(OE7y<ٖ"IC>UõP[M f_lJE[--^5Oy[2ɨ}"k@:`$B>IPA/¤S.Oi)iqf'$mR#%}b7~ ^7~Fh p,+ݒsŽdG, z45C3'KҌĺwojIʛyfecdV&7+ʺ׭5{Ȱp, 'y)sF[ f&rwFuxʁZ2fJۡ)2An%DהrZjMѨ_K̺:NUT>Y v+1gMOVϜ2*٘߃ތ)oem*;zK ~ 8cm2Qzb3^@xw x#9LqDaxGA"EܭbNaiaW@̬Feo#wM 0>\rN^ bljS##&8q+OX@q`#,ƀ i :~Š8 .N==:VQKJ) h4)MmXЉ]50ٲ2HjK°'F8aɍ"y mâJq*0;5IPD(&Pa?}7zYG9HDN+K%/U+.ѼчTsGšGy\wsQܓmDSC .Hus9t!~ٝjlofݴ]/ cK4%t_gD,1QD.a8%HqqR5&TyfQe.>(+eB0IWvQԙ +q"٥QլwjTU% 4Fh TMuh>.9/#Dqymd~*䫁yר{i6ނi)6xN壂;^r5uP(~2cƒjWrϭzn x$ tz.@Sxx% #j#: #f ~6OF:F/`R*PV0'H`vd,"IE.=2A2eW  woÿݧ?<OyOA? e}@%Jɐ_וv=Yk~Z|-Z7u{c_8%mvdTp;akgQ6V"G`q4 Y… ” ֕ #WQi<0܅QYĺmԹewS:1J֢ 2 .6vq iѡc(LZ2JT0U8uP:6ZII?cp~C?}9tI/}trJbkH8=sFh%=RG)̢ VPnv\jTɓX@Zܤ=_dg)g(rء,g*փ(FuBE 6T4u{ U:MH(_3M`{t&8diUlҀ\)]dDs޸h)})M];9V#TXw v<]0 \tA䂤 "~ 0 |#%)EhJZ§rHjO'ؽIXLn4t9R6]&iuNQ)ȉ>(vF>xFVzV|)'#AtctU.A h:Vat"덊mhGK~p?>OOORß~q]VG玷L-uOr_)}r'o/^hI`+95vUF av蘀tV}aB`k55zsص е3p(8av'`08얝xvY#NGU*5lS<)X,>(F>FVV},a^ᄠFVBGKb'RWV'TոXK3ǕB,wqT;_aCYZ`S pa|P\|0\\ \x kxGq{;}9н AݣqYHDGQ\(OQ5z`69Lr {z"Em8{aKhn6*Tq7t&O4T%P}A#ed=iT7Orom?l8D:#wΙ;)²s'Hw 'kaA'qGcbw.=v o pwPSI;ة7w똭`оʍvv]c.=zߝGv>;lYһ9Xpe!.c[U ;\o#iJߦMYoOnAKn(5;8fbF Ƃ0H#18H ݸe:|MzFQ!ܨ_FM:zCS&Qf5kD>_Y!~M`x,{+\p$VD FM̈Eb~ Xh3oODp Pg;}ĮRʾ:$lnԜ.R " R Aa&fb`k qٍ(Z&=̇6jMIvE?d7Q^5wh{=^& NÄ+/:L,?NHMƝu56W#F9\ymqH_X`xvb8P(`(Y!(XQw{?' 'ݼC;.3;{HƹV\jiܰ6(U+aEcJ> c2 pV w]ᪿc$~,6QRѻw(,jXqF%S\af8@=ݨ$jt8IT'r >DVވK(U#!ɁAhFAuؙА! 'q6!ROQ5z# & _yc9%LK*`HcXe)6alÄ6uӝU9J\ELY* vle!.w02HV=75dQq/{ D%ÓSeqW&.- F ՝:e!Ku;]`%?]yQ˝n,T{OQr̖a7wY,8fQTh'x" mT4z+S˔_}+uPŠ~-AÊon8_rp*F>Y!n``x*Gz}GOt_D/a&x6RP)z+@ך:Tx =@0n)YF+Ѯ`׮Z_x]8l'ng̊' lՒ۷"0P VuS'2mC0nkYyHo;F4R˻HsH:X.{s2(ov.xafZGk1a.|\OYbDZN6/w>z 16 >&Y!Ⱥ;gfTc#Ա,l *E.Ah"Z 9=SѪDbQ`Lv1.Jݍ8mGT1b{=f>}RpT47\QB9+bXQ\8֯R?xC`S㘺1a1u^F\v ΫᕑIk7Ixm_7nhCi! `>\N N11Dݸy5yơJ%fF.(G# #++nG".( r)'J~ib pO4QX*M,nlŢΕ 79yZ #*҆A:bO=( m9QDlؚ9V%c2-֛l?N`P6M;3> stream x][%m~_`y v^*`@w yXa?d}A}JU"u'UvlwHJQOOܾ|/?~/?/{~ܞ~7y[o_7&MkwmY]qc矿/؇4Ҋzņ=!z5/^e}OM!NUqwmsq?|P?AǚGqiXiNOӦ \-S&]NuF݅og]nƛz ?}o/oʇZVcv7IݾX5xi#ooj~MDղp޽f ޭ&*i&v-X2#; swg{WU|uFd?MlI{#2 v'KaZ~ۗiLPr e#ޥ!fJ.w~76%77ucEwi-riBbaWKOhFzTlG(gh)%UWّUU1xf 랥FwI݆6Bhʼn]wNyT3uާ'߾G~" _PH-!VJHa`6J|H^ 7$lXX3`76>q\#_Bm^:{iJ@I`A[&{z:9![UL6[7蚷cY׺)$-6-x9u+?4${xLr(=#JK`RJF vSWL46_o~ӿ"۷;t*o|ݩ{ CeC-ox81-"oCry1 򲧬Ϗ/ LWfI#%J̴䰒[qb8mGHKrq3/n^/›E'YK]eh?xr a/bV!ÉeSׂ`:!gO{9\/ FZb &ѹ.slxQ]&ٴоK)-Œ M˲l|l}R -dN#xh̳7tc#lr)d6*M﷬OINzu;0o[W|\PP[֭E?pKI>l+mKqE6*U~4y=#G}}*C0~4:iDwqhf&[ǒQPߑn45BVfn]Żx;_t!IeiKckٖX:L$܎3cŒD_40ɾ%SGk+'T^P'${h۬=d+BEl](RDk.gVMeM*|Zj"eFahӚᣍuJR\CCSZ,նv!ɳ%͒C&`D !M'nYX(  pnU SVȘJ9 yZE-Bʭ^#K5'5JX}S #'^z[W^LJ.n:֓|'K'_w8~Z=K]w ~CglhH8Qz@uP4)0ww;W$,V l 2:[Kz+vB#_g{vɈGT}#ڔj^でE8y=񴻮2*=:Wfz҃Sǧ{ -cjv0V?m~`6mWܼ6{&-YfbPdЬt0܂ԁ 9 6ŕr< +0  h"`PLh/EA@T?\Te iLn #g>D8ځd벡[*BB2IP/dX(@K߫z{}k9I77T fOՑ8 },ݶJwe1Uʗ'$Y( ;m;9tWE{7s oFx/—!QhQ/z >dl\-JJBzQ&pQ&% vQUWq 6X`zx^CUODx]m%Þ0 fD ]*+ (1eQ2m(Zra-w(QG q!.0zp? mCer(b|> Pqt0Hr0ёQ˜1E 3IHenbd)F0U,bZ,+ ޹"X 1"X%dUeyj,YuNʼnӧx#e~h5Ps)Jll2z%`Vj% YQ+QF{|0"U¹lx%y(njca7@Xi \D+DLbIآDi#"ݗkLH@1E5u)ZP2q̥55ƾd'5*ט=6 r^H{v: /EL~[mDgr" Xd'YHS9Q'{ԭwR@@M4R;ͩCYobI(EN$9Bkɣ1$G(ӶW?˪ U7K3&иST] !K;\(L` +83_3[Gn q-;X^U>qPÒL?MQǪ̩~)HHriGMx5/.CuHAgo"3Ǩ(&^4T1*AJ&U 0J4'!jwRG["# X`!H1HrL_mҫ ᱽ* :|Hswdyʈ%_Zb/0)(MOܡ bdV`;9gȵl%kbwl +mΈ޶.Pi~{B]9udo̓q]<7pʕ75K۸S|ܦu93VD%!ub\N)V&%ˌ6&6@֟W*ԵXO.K0ck8+Ok 9iL)Lφqsq`OtdT%&S`SLJ,Yxȏ3l`ikuZT5Ytʍb!fnD(e+^tdT)R̮SL,v6OK+ĉ*)b;;u˳*Cn})L q׹1KHEJ]|jLT-Oϸj^cXu:>=n4qQ.Ok 0isilGUxPɒY,I5TdbUeIH#HI>YClMr$RY.%UCe:{o I ,m(IlL"966[|xpi"2MU /N%6U2)M !'zN(1lD!\2[fŕ(!@JVZLݥ%;(* qUa "ΐ7g"%tiPo.*ClgŎ|s^>JvJj_-3_ a:{ɆVX y xS(\dCҚM'vvJ@U_Z'#Bu̒ p t0^zBnaU/v符`KJY#AߒD*Y ߼JvFr؅vY(u3Rf%#36OOiQ>'CJYn%NJeJ0\ɞ,6 h4AAʷ~{9 */:p>P GQ8#]oXK_MXQ*K }gћd3\(yVwįܫI80/W7v4d<c;H wɶ؛9bjT9QYn7sR~'7\sR cg`eGU%UxlbwNbx[8Ăx pxB_p%kYeCww*a㱿K)nKhٝ3UYoۢ7 x=apn WpٶJ$ƾTƢOH'9靳Q(jo0Ɵu{ e ׼q9I-RЛ26&ĊؤFi'؄JYnt?zNJeS 8ãpslaͩHJe# O{vl73mʹhKn.03bl&=mu `6&=m{ )lјس*gQN^l[~3*muȃz>\-lu_r0laۻ(efkсmEA%6)Vj꘳2d3Na@OGwLMVgZ?45VLZPi B#H+H>h&Twͥ4'H+H2vR"Hi/ y(&pZ4Q,&zZ-#=N(9P$ ++ũUJfh ,wFiu!ܹ17p5p UwdLI7qVoYK[j_2]d3e_j&KR &?eĵ^Ec_siUz>r B'lx(Tɣ<_:[{90uӪEK_sgU>@AlfzhU~zxշӽ ]ro 4 ̖Ć2-CFI>x$TRUa!`kR [w 02 Xmh$3[|b\jxNdUb^Bվ°Pr^i?SY-⇽|\XkL6|ֻVc%}GAVzl}u#9B Rry8ZT$OZPƋ{0S=X_WUa2CfQ8:L oFr7f;aĵS=KF.$Ғ ڹQsolVu ;~8vgUK_pƺ0#0fzhɆk:rF29vwJg{!`kn3-p$?(̟PYQ0?'õJY,,iNI2,,Xc|G,6 h4AA ̯40aYg1$Hu,ίme_/o]d-'_hJnfٿ}:ɏ{=nINvhՖ3OF,ס"DjfbXDj fsk@ߍlC>WNm u|K]l85۝}dEӦRؤ(%5xNh/&: H&9Af@*`Xe;m xdGE "6"I$3VcA2`` SP0%c~{ay@sT;S#3r Ok -N7]J2bG~{J+Tsw)=CfZfSzR$wf+KLz:j?4sVw.kVl)=#:fɆݦ:'9ݦk {ז令f匳/yT %kSzN_ZMa - JhKL6)>=Gɳ:#==!+bz(pMR%guySR[xz>C>b!X@ h ̀p;G9A8<'@A2My~8m)=- f=a7ݛX.o `fȲs{FQHyTu-[oNe=\Iak'i{$ [NqGh۞3 szʌ% ayҐ03l{2)>gɏZg[p%Ԃ7UdϠ3.]u,ȋX[SWŗ̑ =9b*WDZ`A;ntTpnUmQPa.7[ڲcRr~9 Xqf6OcZ[pPLxY%j&q0*~ T/Fm)3)5ǝ:xo:hujokB.JRdt/9qױQerJ1,зє:Rc@*G#ʅG[a2)8ZtUf87`*_ƍ.! X@qcmeCny1 L< e+ڂ. eY߆ УzsX7ela9>f6J8qnc8AG*"6`Q70ez74f桘@)hEr8IcQem[0sbu XɘMRJ (Off;fQ9ܯ}+*aޤN??uOb=ݺPo R}ջ{GUgAfʈmxs& 2-&%8+vw V8>+37{L/3FT^^ϣ #bkRrmд npQSRGn dDuu4VTSr>씜0Qڗ[&= Il&z>d[P}A.xSR2bAE;+/]S1P1ȊZ!4dNAI3nCsdN*8X1G,cz̈؆`&H1H2cdvpb"qcLIxLndy38ɍ,()Ʌn/vpzNע LnvVNdz,Q 67w!\3×Ր"$aU<檪!7jkHH46ؑ֐kl~wU /rd3TUCzbPm )kl~mUa-²dcs]$\!\n=8562]U{ },J6=MWzn=.4VsL4֩&9j`fjYQFI>?I0֍giNIy!6ϞE "6"I$3\9wI l~L`s]VsST`bswK a9#lވ>9b7`0gyupff-ӫE`Q`՘[arSUtSܴdVo 6X&軪`cL/L Sl^?L[AJښ-]xh\,3.muƼn`+.Uue׹X񺭪3Gyn Jn?ZiҗYb X%jZS=Զl/b m2{ao,Wjb=Rb=")" ^%U[7gg8E,O+Xc,|z>#`4 w;[vN>&Ôûԍ+o6Wnf6>ިM 0GOڇnQ;}VT%7٭A?Џ0O?HW} /Q8nIO Īt =UU*uI5@'l t/miU(Ӷ[;w[Z)mTpy–0'!3rUYu+%J%HZwbr&(%xu6 W=K^`kRfXǷ(kk#Ͽ Jl((Eh(HT leќeJ!0V:!gT[?tK|zP0>MzRTy&r<ʣ?n7RAJ [DdpCKD82yd(ѯj~$NQul 0w 퓹[cS۸k lISp tGf]<<,:1p3mYdcvX#__|yOqD/ضDCrǠEkygEbE DWj\`|Zb'}Ǯ2֯ѷ>iIWc_Ŭ%#/W1˶dZpdϗe˫-!\Osjy/KF1#$]Y$W嶎w^tU#7 ;u:i-f*1ǵ*,)l,ɵ-8'׶Jܠg+;g׵-6J\j w4' )"C9>RY~ƞVHI$?#qhVZP]@C daOJZZBq1#ïy[:J}?p endstream endobj 357 0 obj <> stream x][9n~7pLY `$`1 DE6=>,EJGR}x/?}߾}~ۗ>|O_ׯ~Ono>Л}z#s}Ӗl>rϿ}#NIK7';%[d<0oͳuc8!e.;{üy* 6m x+j<zfST얩OoF"ܤ`7#F߾nI6&l on|۷0j̬XM k$u×wVVV^xh"]ۇ?y fЍa7cnts֠v*.{Hw̙8c%2Ø 4 17D}( ,luj&͌/n&S#׎p6GHH'nrJqSOR(hp+Г)L꟠mRGs+Ɔ {N@ ݨr7scG'--Lg<[;D;߅c&μBS' RP2rS3YHTQlqd`Jݖ$vsG2)IS= i|P uWLaUBl(\va wM37Y̶"qM>pod X>&>Vו_r1,v;iR,9_% nfɓS&-I. ,{ўGor;^\f@qi”p1'zyS7.|rp4c@mIȘ@UP07#Z5s|SU&YzUx9$ZbH.K{hkk.N9C'i0&`^'3C묗l\G :=O6v vb6SQ/6*n|`qȓF%6^%B<@!eL]4jO5j ,kjᠪS xc\x2ȱ-G%Px<"QSqL*1hk 6\Nc7Š`Eܡ_9R X, IXv3C,j*^_0* @tXUU)Ecr Yhg#bhʗjS[CՂ\!UA[`<[{,- JߋWW^ co"+LJy +>!INb9@F0T"( 0]2ӀLxYh4=O dgfagADuQ/S%\L}Rע/62R/E3Bc0hhwm/HRa-F%6 Jb.bBUl0cwdPђWCdPqXKJkTrh8c5紉ĠK8z`K>U.0r!`<.ͷr-rjy=%YWxU*z l斌fbU6pf*ނ; Df(- u:ʀJBU%61pqfp07LH 2LFn$FhymE-k bnrc`כpJ L(f6rqsȥ ʤ)6y9|C὇JeH逩ż)>)G1A)h)("e|p%RڲUe>zOD'f3Td;BKӳ 5!bFIČ0֔37^#_q_koSUb>]+x\L'++%U)yD8M%ٲ4s뢪P)/ΥXU?ML[7(mϯyA} 0P ?_$Q#i@} T:(b"cgFۜH4+kIߎ!AQZ؊O9J[X6A?ф'('ՉUFڼR=`7@0vS`G!d@vɕsdGi*>ƀd ڡl@yS:5bm:{2ȻlyB[;lO\@^# X[+֞m[klFYR եEՐrRRpRDe7м>OpX<#b\!DL $(0Eb@=mTov@P ̪KS8݄ =Kq+7 ٫i~sIxL^U7Qv9[BWF|mZh ab6  %V@t= qؘTNP+̡L$8|<Jb/pH=nHc@PgbR'qةX qi[˳[3LPsTAWd'JmQZϾ8i-XЁ`Vw KrS:@e)gրWr[T5 f0.d8ͫ 2$.TdʀLݴޅk:%U!n^yPL&&Af 7#!(ƕHTYg)K=^rH@/UUR'⥪* X4^Rx)^]"^أ4+qRɓTZbx:`Y!RuŅ:eTv"RtY5p1lg>֕ XM8t,DԬ8ͣUtL]]FG_IYlpUi@A`蜃Ƌ$0"l 040&>X`LY!0;1$#,5whY&X"9&#-xPɥ˲pX`nH$Q/Dܗ*ڜTm0[Fıg &1?PT"iN]-Mbei.j C/mZ|BK~=s)ZqH#y!@!Ttۚ.]ߧpHۥ VU u/Hxx |x`2Bed5DrLdYJ$/})K$y D 2A \X4^j7ƋD>3œ,nZzR2lXhC  fXU@ŢSE1vRrՒ`Z 2氈n\bU(Q7e"ﴪv5HY%B@:aHX &1 :'f[6W@G jA2A˅2h/DEWv]yN&Fé:՝<6(WQ)`JOkm"VAjq ֨vo p',mt?)= (@֛G;?ѢHN\,VQ.jyF"r}OQLJF7FW[Ϲ1}Vٵ]@z.+F1 UM.?.rnB˽=h .G{Ml)Nhfxлg]ɫ@ܻ|N}k:OUnV^v7.5ݪڨz  ‱ |B)dłj\ fJp"R>,)!{C<t4 q \JGe9\,NX3lCŐɉBKO^z n eLU*d&.d@ew[xf[%awOTxBC0%*d !s:a+NU*d&.䮪7FEBf߹i #q\ B56dyA1S62&>XX!yjddّ tH 'qi2x$Z!~ygc,\B,'O]n&bpɌ\7,&/ʇM:g'*7iYpQa2?O,ư n ew [ەLDGR4mmK~>4s[q:SӴW;-acׄ*,Cj3`fӖU M&S%,PL''Ag⃅ 8|31AP8#ff)4/1_21ABBi0'2NS^1EC -aFTj k$[¢yg4ꅨFݴvtM|M f:UK 8t~&MR+cN0SoG'z,5E j*mvfG_16ay|=,X!aNsآL*NxE9ir r (6Vf\hT XmL:i!DqYݷSCݒ+ `.΋i^,7qu@: asɚSh#xmCB*vxNm2.\;_fHG{Z/O5.(T5]('-6GC`a>V旉sR]dyt2qNڽ^\8w艎0Nsls}l﫡e>|&16D> `2c56mt/bq^,QODKsR_} 7HQ~L@4/sR^}\)sZnbPlJj؋5L{[-Ѭ9/ơ.;F 3Yy&GR՛d1. yM`1-y~xyRR$qG]ChTF tTa_l?\9)`zH][:kթ0C.,f")k"Aj$( uu/;Y{@ C|w2p'd2~N<2PxuM; r/q0HC;Nzt0-0qBE5˷tͣwI=f=pAˡ##$FHn|{W+ @D-i@Hk {D q4 b^O.żŢQA/\w,@Oj8`2UVO %< ́ IpӜNwc:~fƬΧ;O(V[Q{btbV橯=e]H}E{ ݋9,WEИsPLANŝ <y# N2,%ki U! D>/a >EŢqK2ZžTj$i>UVLUW2S> stream x][$7~oP8[ 4 UN-a<4^뇱ǦaRBwe qedDdD*p?~ׯ_|???>|_~/_O.z?}C/C/苶doߐO_ww*$wv/Z97Hvwnŋ!Dre?.W'*qB\wo;^Q,ڴ)x|*W_*$W}uzbMRKo&ߐXEH+7.F?}?]~ ƓrcmE A޾_^.|5fk,馅5v|wVUVi#]ˇz A_!6%.Z /WpEqI!-hE@Jf3mBx1(%_қ|I {E?QqFZL}!t "c":L!14JQ%׌= `@F1!'R/cPo1[ꌿ~˻~o`̝7z/$޶!h ,K!FIʼnݘjz`NUBz mGlBO8lelOaJ;;qQ BV4ld[okz\bDGPWqˈݤ.wC(aʙ(`H"݇Q5GCDG[90zf1=p6KiMo9i6C3< t:p{{e{qk6g"Wܛr"Xݫ咞+c) [۾H߽ћc_p-|U%i7*Pw1M_. ea`EngLg.nD+^_1~^KSSav82$ޤӱVq'|s4SdEi]o<=8Gޚrps+:pvKF#Ce6q_ڂkW!%4g⊜RO.<%&QHv[axuxx?G=ZdWa:C{#? 6e" v,rRBW/%BHl$R7N'#"mce+Q +'ţ0-`r{l:#^ϴ^Bhy&iޘX ɰO!PGҸ_<̒ ɞVp J ݛ-%|Ȑ&>6u(O|rj*KsVjYEN#%:K4 Y)ѤpGj뙌K1A<@4/Ѥ,'޸RIUw\(>(h d%5s_gH#IM@{+Q`iplƞ 9Lj6ě}Lppyp36\;_q9n^(rTp;9X p# c=AGu %4s Hd˛p)o D&0*o2&&17fLz&ayhVjqhfx=f^ި7쀡"QQj(rAEs:ĥ!JUlէu`e:FM0Tn*Ld&G?'9be[LgQ uEݟm o6K>ӂKW y&Sp53TVý"Pp}oݶ* 3mg>RT)¾"a_Aƈ W\DQp5TkN$~8l>.Ax}XpEK=1ӄv1E*е#Дmx'b#MĢ(pR P(XNc, ;^9(2L%C<(ȥ [FY5qp6Ka4bl%nUrCvF<]O|Go t%@4QR+3J.sK7\<FJIUZ(:hc &FIB\8oQpٽ]LwrisRGt )+1s瀙aZq6h03GiHCE01]D(ebF-36 jN ( ;fHv~+9fpqW[LsiG\# a(덓P{9JK,۟vw3`RE3 lLew0]L OLp589? 3~̜ӊӼΌ36Tt4]ۄA1P16"lcYzLƫۘN-,o4នې @PUK[? ڇF݆)g,g'OKޝ6vB o~e^\:pٽT߇>}+N(pvd6c;AZӱNA*{6hxw6-k h hQ4:(&h4>(%>%VEVfGʢ!(eQY*↼F~R-9(nA w.Ep.("8mf2hs8(jkKV4 Dk Cv\P B*,ئhv+*& M.ZqTm턺Ϲ꼍] 9yETV\Pu{٘NI`;- b[xڮ fgڲO9kM0o16EC A AH6$~4K[ܺ%(Z r D 5\-޹TUp(j2靘A[ismB5ȘW+\e9ˣU*hr bOi0!!&gM -iv\9&U c,7#+A;dߌgj:Gsw+stSfS(Sobb`, P&AmAi,I(SFwUUR٦R_L Y8T' fbTA+N=E8Tp ϻɭJ<҇7!8ew&GR:869T~ʕ++Igj[3ѓZs3m' K(YB D .ΥRM\,zb+'lա%U+`얐oEI+ ?Vu | m+TlT>jؗae>+NYW[l2_.&t;ُ"K)zWF(. ҾO˃)״[k*FŬQ)vk b3~Ĕ品~؄t1_2>Kj}ҲgpBXG'sZ[0&̻i7B;~ʕݴ LU (USA*G`,( |Р`A9Brd91(sf4'~D < z+ j/.Jag_^k靲+Wí= *m6--Ϊnuii>5nK)minO3s۶Jf[7U wH^Ts*"亊@ҁW@>شiXDt83ah Q`2j7~'rdʻ +}}%7re ;j+6V.Z6lZUgAn`m e?Ta=cIMmֶћqq?3Oky~ӗmwNUjRc.bE~*(49cbn䓥!:fbXeibaq;&0M44σ,;јR'eƙZb Ɣgw+m12BOOsb/IEYbo.拾ީB{’_f4r\F=Suw\`Y[gy渁q16of|7c5q+$=,CP8sH8#3?I-P=ͳhFc|+ f=Phg 2_[kLj=Cm$/uʪ3{Ѫ@Nd\qd?aLao@RC9qUSʖZ>GfIpE@p>hpM|X!5BaN/=X'81@1)jd#9`^ IPzg4eDQ\'hXrB::R軕onGtu[~vT붞e|˰nk>+N̋U[3_.|Sh"'YlNU?InfS <؄'RˌZfƩeb-şQ6:7X`X'>$R''wV9$3-'/;pd/uCWj Y?I]xlIZq XO = 3gC,g]XnQewvqZܲ`!}@×rzۍ'O.H鱫c#4XY)zceEEwiMW!y*O=-1>t~Y[@ݞ*#?+݃b@Wk⃡kbkdav‰`\FV֧J[w; 2dd%deg!usYag8 jAB;/H0֨XUut`UӸR=i{cTv HNNt..TuZocl ÛAq6ufgitB;\& #8rHC9Q0,~3qcM$qdjqZ endstream endobj 359 0 obj <> stream x][\7n70">uWaۿ lP}0!H4lE}%/ԙq x!)H?R"5Ͽr˗_?w?w_~Ot8ӧ_cr# =}W__pq_p3.Lހz3 QJTӟ_[Q8ڈ\nL>o7zѪ̥ܔx|~Ĩ7 &Yb.TL0IY+v*Tو0b9=W/xBlff2 C<*.Bo ݚtazNnRؗW.ҸΓΏ3nP^`**[f9[Z2+x=ĨT5(ܴ?7oQ;v|'G]qfd􄕮2ĊGr6.gFdAF/xgG% Kȸ|2/C/Ook3 (7 ܫCM_)!Г(Xdv/ǡir:H 9!o_cJ/gZJALͼyS74Weav[3ͬJ7I9F :/7zRPy3 N _/p/D 0kZSJZD@ `4>O|/@ak+ޟ-a#+ VY&'IFϗP.G۞ف ԅRf~тu#&R#^T'Aw~Dx["蜠D#сHTUhzH( qcuIrlQ~66%[MY0-1|$qm%:qYhRH*˔~YqcQi1p"mCʞP'l!?"ďs?Ѳ_Ͻ2Ԧ"`1 J?*bsTd)H4uz\)'\ ݤ@YU, d(ɒ&3&>)f,BHX!aKedJ=ˬRDy<'}45I4@AUR 2%d5d2RCf|d2 mHj  ~=2&Q>82WY\={"|F|1,>DW \&}6?`"Qq?:n/ovg5 淲L/sa7)'s.jOFi "Fml`2bL&Y*2%zfլH4 @s # 92=x 9` $񬾋5iU|'ω`i Ud5@rA.HN^zjT@\HY<+ |pU:>hAjt8z6^AV|uϬ]a}-iP#x;E6^E7Ӣ~&&7ʉƭq9!*ؿcdFh?`(m~؟E!T[1rXnRZmD@c'UlۓTljmw܋*XNl>Tpv|4R0X؏N z -&bY|zb^P%jTƴWeTW>PEZ~SsL-UTYB0B.J 쮮\gPAܫ.WV\. jhR 1q_7 ?ٷ"⑸G0/(zJ(]4x+3nlGFYّSѺtn]uQ_9Z NZFiWB3(,P;L/0*J2טJTck,Dcb0Mrpj]^\EpЋ[fs OMFYBS1)+uókngIf_1(P'Ъ|4\ՂagC^^We~ UElam:pI ӷ1twSIF?aP CތQcKዝ4Ƹ#a砡{Н7 Fs_/Z{(`ޡ!'%#=w|J'ኮ J2SƘWxg+xҿ2૛+{a;6';*46#+B&=< AL oˊsfOcs!\ Zwm0aB.[_%cWŌG5^l?qtj8}D˦v6fq4,n}n;zwFp_OGሗF(A6tɇXP kdMT.9皔T `&fy]#(^f!C- v\58Cƣ jW_9[[,r%nĿ\ P< \8Lk[*Y{51[{ԕf7پq|+/-l^!FYs Y 8s ( "7֋,}\l.E!הٍ"BGHEĆj;W+Ocվ)]3M;rWXda*vd \Q@5mo.˺YY`ٓ) "9rhĸ3j :;dtb3C+v𨱌j_8'(#Q* d^l^w'c! Vn-ŢJ<Ӎ:4؝#X B-`.ЉFq]QVn/}׷юvd4-O2ů`)"l _*e7FǮ|+DTi~Γd̸lޗ :R%P`%`5/̬y +L3͑2zH 3d_9A=&n:KOD]gX VWvdy!Ti;486Ye sMTDsVpso:e{\TWҥZ+rsx!yղ<: z6M ֳ3}*mCr`:xXH5:XJ:zڴIc h - Oz@s:7X}16`#5ոލ>}ޱ=' ӎLscRyNe6s:сSgCiptRZfWfa#$?!*2Aȱf:)"h$X$IuHٓP=$+Hr >=>/.{@`>nm8R=*ѣ&M6?ֹmf 0oUn @$&ddɂ&3+&w39AT8L3Ls(L  &8aN J DGn45L']IjLBŢ0)ƪ `6hxPQ|hv^`OH,Rddh]R{|eSWG\І:Ԫ=aeo&ί,u|XOy:u^isSB2wj떏e&BfSl* -2vp<}8z;aO{PcL5"`3 F"rOP>#1 .b{| ˝_!E+|P(S"l|aFDdُfF@*wv%R7'E>t;+w{Oy9Q)S5kS6V;:PGW?g*|`/P䀨)|&DM  ziEHʪXutg88ıg2 &C?b4#`#U#H0;+m5bL{N5?cE#[iEkN2rir(#n̍&&4':e yF4<`VY NN-N6M Ӆ#jhqO yPˊG`|vnK)!_0*b3}, DmM"ls$s6G2'dsgcUE07;u_> stream x=[dq %0xztз/$$ ykf!Gґtgl}JUR]$UO?~O?p黟O_?~oOt7ɟozv_}N7_>3\qnVgU;gZ]zusYcy#ȉR,uI{y>>-eeٺ g.y{ru75K`Nҝ; d򑝙7)qf}:Y3'ٟn ջo~nO^B0s,ܜkBZlz.hTg=+_+xWu&=;7~WW};.&L.<(u6]b-i)AӵV T~0РUS ]f d[mfȜ*DaF)ydH&q=|\|; -wlj"1CAp%V/M CR:Njt)$H788=9#iDz=5Y3FY3Oݮ+:| D\ݶP\M . $2~YД8rdlʷǔ)!@SƦ|04;)HF|p'K 1%! 0bDc1$iT D u qWM\DJ,1:\w}8$ l*chSdphݎCsm+S] d1cg_L4XQ *Gȃw$@6zy `!q*"[:B~ǯF=Lf K3 0x8ndVD0]F̄`&4:%SF{p…+qVԷ90w`퍉iս[U րHg;"6e_5`D{ _h萇w.nz6tUC?lѤU]ڢ#$blE6SFߦ InU)X0n_";U,\'EY;Tebi& K}S$dc<[ܑhеe<,K0J@sTrQTq *z9t E"Ih ϩI 86}<F(3j&vHa7:><S2jq7~}0Hf_;kN_: ~dbX|Gɩ = Z:+D7jtON`3 {> D_Xv4+sU]KCceN(NKU's (5&#& Ə+>/ҿ0(WtIU`/||lmAa}h1L4\dh/).wKy9̡gF,C[QW(.Dž|[862q0oKsP];ac|F`AvBjÁGt`|=#w\ KKOQ-CVGc('b.*EI;:D &(1 G2D52m/&Mc~ֺѯGN;ݨR78/d : < bacza&d%;xu8?Әɸ{`t][Y'>_ʊ_|oQ}{B,cFc (;c\ZWH/ + /Fؖ+ p1"ڭ K xncMҮ4ՕRSMf)|>.c$8@p]bԙ"[I= %ﵷ)ylwI*`LU fkҗM;|$[̆ $9߃EtyyW d!ӛ1^U>MUr5²uënup6]- 'fٚ,AxկK+9Y@VRa0͆'g<$\Bb@`/Bz/YƴP[4D4tRk XNnTM%xG;jd(oX}؇9}}h>*oL=Cb[)4tL. "bjQ'}0y:d)2ލPL;DCia6VQ WD&$:0iEP*`ae(UC+`rE6,ZCPG WInȥJG\X|,U#LT[k|stpэqu;f{>6!ZWh&=$gZLޥ#̍L5dYML90y㚉6n\r} A5yaE]LK[Mŋ@CC~lͳ#|`wPR߅N]W;椉]-1h?rYy'nW? .ƖZރ[ l@8ݸFuHKO-hC^/i8i&lCךpضpd4V0} hnq-LA/&&<9B:E!#m9P,S<|ؚO4f2Rn0JxhSvF,޻n3P3>Mh]H^dx(#?7bSHX^ʻ3%fiiRbȫ"L{0*i~؄* KR߂M\Ҁ) A?\; *y\P d4 `i%TpZoH s ;6@&xCgXh@0@㥠s0t]oJZ{7w% b ;h\Gѓ2/40Mm\Yuό0{Z~GQ]4怆$^at+i;4)6 b2z]D8a H}{C-Z q_.IC~a $@~,!k폻 45?BV*[#=iJ)F)Գ&BiIl&`a$k?luIë`iƄ LN|n_$7 4 Fӵ5) -Fl0t#fA|s=:2 +&gA3v3Qm mb?So)Hl{Uz(ZzRS7;ZΘ ۛtN YS0=7nK'AKxa9xDHshT މ!f<;G&-.OZ}-by;IbvvϾDJKO=[CkupQ1 2y59lvQW}mϕ{R:"`VY4&2S]i]{}}t BbC՚/7Va\*w }@Yq8.pXWR h4]5?w3]==[eqOjvuoQݧ˫"U~re5]ENU~a]ֈ|<#UW[hxJ7m}qin.^!¶ xUƷ6.Kz̕{Jza5Sj;]55W'פ/NwojVك'!DDbp)xhɨT|8)'xੑ3p3P_' SZZN6KPQqۜ%"$!"C2l|)qĎTľD*\ke,U&Czh).pkn*I4erss(NrAVHq5y ^0KA` ]m7c .ۺY߂Rb7cdsW Q'4)Pth!{WJ^7$I6d׆#`=]55y-xrgCn;!7EMN[ Fx'"_yՈlԈVo#DKD͗OL_w7*Nu_}{TkB5yAi-@hcMӮ0x+Q<_Wcx]-,Yz:Ө״cPttkD+h}_Ӵ*ͪ@?_aƕTW:xIՒP)B:!R:kz!\$Sya \~j_uQiVXs)ܜ." )xnc *pr` ryzm+g/u~Ө~l}5u ^ ڗ/c,[5V}ZA YaOɑ-Rε&ǿ$& IrJمw I$ I#aVv܅Fw f%Wu7Z௚($K{ԪfK/J\64yk]4[ji}< XU`n}EUT왩vvڭgQw_c4trB!=AYh=gMqBWO,IYO0Еfd&6;Ώjl BLTq[ j(G]$WC0OE!"+$91.tSj5,u[J klVŤӹ5P 3oE[xXW52ϠJBA Pq,=֋Ťn2[I%;e!4f]tu\V`,fakPk{R"̤CotS1)p8VY.+ώ/LuԗIR04gy:ـ.B#Ta1e%tbR[UA3S0VQ^xyAO[ /6XZ>IU$VݱVbR ul[_#UcFc8=!^Mph)|KYerɡLFFBS#7ԢC,JłQJ}5a0(ij2_; .dh҂R~˚+`u炆U8Cf#~{z ƘWxOT-v]YJDtD>㞘xmc+}P[1hu,+G\ !'9+7h58mãHs#2'  pP;_ kz(ba%R/=}nђl" $CpZXiC,zXAMO.gTt{{Ck! f@hu$`H\И&V![qF؜(d!d8xG>9&9M.!b`=tA7/8%:AV6=/ܰ7e&>C+;AfX :]u¹qxp&G怿d7$Բ/g"gL[}!7Ѥt^[[ B ef̍6Hƍ}YGU\XF98j$ ZLlѤ4_m.t8YD35ܻ#I@9y`񥙕19i* endstream endobj 361 0 obj <>/F 4/A<>/StructParent 109>> endobj 362 0 obj <> stream x]K%m7,LR A HY 8c ؃ATuۋLOIH>=_}__?}oï/_nO߾;z#ƹڈlݾ;r?g" *Ƀ=ijϜ;WJ${ų!D䉙/}^ UP?ߩ@ǚGPjӦ'AvMCQI?Y T1ͦT-SnN#!&w v3m~'<)7vF݄~#$wۧ?l4fXM 5}jC|^ۧ9~/o?ۇ?cOF&U9jS⦥٘O\()Z;b ?_3|43;rYgZ)7^iNGח$8+ٍ$R?{(5pfqe%#a]nF7ԺIjf8Ϊ=g, UX|ZqYOGf+عv?ne/g1HD)~H*&nc4Tƪ n,J|n [\4[+r6mtlF 1e絉:0jkqs`lBMDR+XݩXP$&v2RAElf m ? & \1(C!ђYQPw27s⒋7Up^ QVǼ6Ef;n!xY4L,xlBkd6D!Z FҕmTj#υU(3"!`CJUr,biPOY!*e9jh CRT,P RYxzĘdg}?c&0=(8J#:hb쉺~ɵ1$7 d% -ArQh詌,$O:9@OA4rG[FD3U\"^^bTa b 4L`HZr8 .M¸8b4utL).N겮i7,l*+z1%G4M̤X`uVw0auC- HB8`FXX#DCD& .X.!دZgZIx%$ch$gh D%D##I$㑤"'1d,&x8mH! A<<-6e1&JԸ:W}hH?,B E J +r/EȈ,Zs*JN3ffťf(#ct|rqFL?1I?)o_”!Oݕ]NgbO!ƸB'|=8Z:6T`&e2 I1/lW${@@NJa Ъ!QSJ\ZgWc}T}ԾdחV_A^rBg3/OjM!neuyƢ*]CF1AߘmxkCl,teDqkOoZN Z ٕ>SW!} tʾoh{HdOJקi_S7C _P'pΗi|eDz͌D]݁$3vY.nLy31۾w6va>- w. _*ɴ5B^>[ S :|".tYk?f*7_)$'U8v]r2)kWr[JDh6i};<H Xaie$>*ɣMWL'kѮKΐҎvnj[bUG%jެ584Ӥc˅-UoW ɖl{Lz]@B(+]w `kf7{]B>?^օ>=>vcwe!O.U.ܛl]<:?Y_(#;ʽJa+Dssr﷿SJΫqT%M0)?t\}BRy/vCc_ASJ7TW"/>:7GW,wX۸ a\0rg\&Kj̭?$N]/3dLiلw"ӃxĒ\~ۈ:OvߟH{h%IFKޘ5f'P!B~P3Lχuԉ҂wtGLȔkRʳ27F|T{bj&߿w?ǩmY0F@ UgdħN{mYOͰˇw t;N-Oiͽj10Tva_}]b`0G ll|r 3oJ ,:}8&$aK`ˆW=;m/Nt[Tu8\q'B ^ hKV3G%Z.f}m 0ʰ{+Ab|T˾*iI}_cj,6u]91\ /(M:lR)'96xK|z}pt-is2At/e@TS:CFFVj8ϣK'MT%8g:RSTQ5ƍOcip!AqhM4*Fh,^>a18yJ63?C3 ?™_噟yh,]T,z4ɔ9>QY By"}F+^g!55,UՂ1<95zIT8GZz뤾Mu`_"PZ#tX.%=2fUAa@!0&@FO  ;%Upm C#ga. (ѩW E[݃.~jߌY0x .5r:|y/AJ&{vp_@pI1 YxDL *9:Tv6eLNm<mB9:jkn,0=Ҝ6RHP ,hBI/,?t@ӔUNR#,.;xSaJ @xLF-y<֑C8OM4*Fh⹜@)Ha:+8NeFd1""U8ft}]<,2?N˺{Z6>$z ܹUcG u^nOj}e'Ҟ! yܩyס2@pmr 8N뷏:HJD]wK@|) ;CʗN]F7!85TQQGоz χeXsti#k 豈`*P5;Ta{0$cdEkȊ J@+^JtÕ#N`nuMvb]+K~Ix`hX#ހ(<\Gj%.%%_݁YgG {*rYRK= fɪ) lv2D[2Y@[v٠- T PZ >`  ðo)'KtX\-b{ McӺVw # u8 F"rp]L8 |tc+E xOB(G2 h](q"0,NF;bDA1gIĥ5K ٨mG 09D .,3` Fb\,z˦stAWA%`J,mtSeez˯&XRFjK_K@:G@P+5\|3gs=* nkiw\Dݶ,]*_ߙj9]``ls>Lڶ/~jyoz%i U KM+bެ8qvBe_ ǻuxZ^ ݝUX;:#671VfkYk"%}2KdޮWnf!_z.8@Zh ]pܹX_x{/=SqF7a[6Il Olugϼ7mr_rx}YrDOv»}0S 6ma]_&,D8QmU`ܯ^xӧ$]ƒ @'A06YQ Md|$PI#SO$ 2aeF #, . q&AfB$dt݂+OCa)JD{%q)'L1F'Y1sL󢮴} G$:膯t`v1E .M[QF7.~B`NNVɄFr)#OpnK*! >]iO&IuRnž6i4>Ej*272=tc7ҖMĆwmbKSu19Ԉ%@7Xl!YK%SlyVq }b[{F,l-veȪ`-qV!At躐u5nxe?d _f y }8314zm-&,(O^*ALNo2j^kkMD8.Q}2kr! eTRˡ=-SFs\62jt2RA )ؾu<GH' 3nH*HPa67J[6eT!u_&GNL$9rBِ:./oWe-ַ+2BfFp%=ܨAzaK[;9&6w,gYY@˗%=;8zMmb? l2wH`o!d. 8 'eB!dIW"c%StLYכrv1ASSg6uEI/t702`?@QvMV(hh >Z]Rrp:-m-=*+4QTdt*@~|tS iLVU4`&u,8?( L*SS ZH}څa;qح [OJ ;RZ @_|Þ]XS?⭒[ZS"mxT+#)r1ͣB4]ŏ32#NR]h3 {u1 P ap }A/tX]MUXc(i{;hIg v 74 xfꁏp+t.9%e#`a^p/K4ܟIc] NJ=&H+q}2{JF }IcN>i`.=|ЄN>aY,bYLtVLxQeER>@ ۑpXk^fb捐ur$'Dm+ˤ@.:i L2ZŲ$L~Ul T^gN(Pٻkg]T~ȒI(?ywqB忴W p 7̰>G\l=kh>.ynNX:XL|X D;z Nb]AK p0܍HU0c7J>ς> Vn KrdddxYk:p25!DT{ WjxYދ_񒜚> H24s>b%.\Nx*`-\~`@d@|S$ނ n^ PL*68͓L*>X|+'bIP YԸB>1B+%U)bq` G =Bw3L%M kBHcA $x6*=%aH ДD\$CW%"T^ vɯCZpQeɄU.&+P6|.:kTQ*dX웜"ˢ\ ~pQs(#&cceRpgQpB5OgU C=OY ']Sd;biO6Qʎ`9}"=њAV?Qx5sq1/@DU"`YfhP du/;p#|b U/O;{Зqnj$/vj_jR„tl֔[,aM:lueK~Iv~>d~!^4)>)A^e*o ![/ >_%=Sp[|]w2 yM-.#Գ||y~!A&^'v]XHACS˹龰.KF/L)m7\H84]y !!bHJݷfK{J1'`;篼KF kRd\y)ڻo)ZsWQ\w99*-'JI.y#kTpS~ ?S"O35ԑt8!1A0x.A4= v` >/Ka:{ endstream endobj 363 0 obj <> stream x][q^JA\@0ThU !kyw?8zggfg|??|}o?~?_o=>??}?}oߤ47M翾}n??/\q͞ųz:]2(3gZC.%x 7ks `gzwB d 㭈VЩB ܌$֖݀Ŕ!E8Q:Ք#Z2v.I9㇚AOӚ1*QJ $ 3k{ %O&Q@ԿdxZk#Jz>jx4JU_ɜ[N*ĝUtrcGWG)4qMW *z>*Hݲ?rIXu(,b?X!ţV6>aBdVTuD vZ(pdWqUh;[HrUr^dUݴqcMB\Dh*eGUMVLuHPIU1{>6[ַ){cQdV/; d2T߰ zJ1P||H@AŐ<9|>Ro1c @=Nd4XIH$f)'4R;=lܧ1< 26fJ|_xr!RSov?"pg ݯ=lE0nqEZF푵;.pob%M߽+_f-!'Ę?S()r"T2$E#/5d\`FVWw#B0#8OVkLgfcįTHLW& S:|L* 9.].껠d2#;_4LteNCA_BxGXFZ.Oh&1]]v [q,sy,?s+WxdPxW{dЛd4P{jAE2ؒB'eZa¯;rPE8HRANt@Vk d BsuY|pd*6Jˍ.>ȗ̩  ؅!_{(ZhW<rB#Jy6{—×/+|?Mm"sW9 t p>q^@4e·W9 `,p)r }]&t))A(McTe3/wfУ3 5Q̤3ϰCpԤda6V3Ozx,a&-`&= \Le ,Rùj.Kkjw%ƙ01GE?΢ٴA%\nڢuOZgb@tue6 <ɊFL{#|Ufwߜba4n-׊3&[u9n%+޵VZroqpo_|XDeY=|PcPE~2baA)weEk(qSNfI=n¶Xۛ̍Ӈt Q70 7 |; (Ĥg0' i9gUq£G5{Jt{'m>!t-mF\;zyz=vsz Vϓt0"4Kg]M҉KCtɇWlv,sZONyO:-SDt=YJmך+BB*Z S",Săc25FJY7to*d Vaˤ"zV5N~gè U;i+Ǥ\ʽ8mTnHWCOo(ξXscokǼ\ ұ0OLG\-Ck)2Up.t9iأXLz-.ao#&5bv 7A8Sr~ Pt$Ɨj BxyR^ .w#LAY&,,#xy6ؑ7m{]_ʱ0/gTxq&o5/<$.+c۸zbԯ$21E*L 1ETSGI=g%\v)&`SUugJΏ"H)^7B)K*;NXCry-JJ.VRxny#4 S[2BaH=lB֓23Aɝ#0uZnu'e5S"ae!aH `%+X;#mʤPަJaחcp&0/R}YvzEKHR=5NK(ԝCb//s2leVrZ՘^icB=N #H/+Uji?x)n~̯\^l7; [.f>N:Ӓ#8p-۪Bq.M҅m]fʶU 6- t8_Z`MJ3f$Y;kDϋnh =;'+(AW:CUT+ͤj\iƸc!Z@HIjM@y݋Tﴓ͡@Qh^mJ^uOTGfI5ܻ)vG=2L;m01$WTb%$ xq80OA/DWw^k_e A+nbw;л/I[^4tiDPQ(2U("J3Ul\{s&{!0š(05id dhV46nςG͟B/\Yž S*#nʴwG_P=02*V~nL |y>+E q@|b2w6煵]R >US"7SD(q8;P>R?\OK"{ܑViGRkR!Fz~Fs"H7$xFI= jb2CC"x&m. db? endstream endobj 364 0 obj <> stream x]]q}_`fm$uoߩ*i*jC+oa{J-MݟoPp \[WoW+%~ }]%>ũl#eyYum0vBǖo]Tܢ3wen헜` W@P0S0˻ Oz-IDlE9Hd5<۔(M 5LkID步YF",z8r;(KĄ UhU|ht2 Ȅpp d‚ ZNQ}Հ ;覍5]ؑG*\2r͸^iV#-_&0.x1p$&34AЍa46> qC ͜ Ȱ\'Bb0p~|[OE?^ƈ +:s. E!Zl#%dF7JF>ЛJǰ4(eϪpVLg9A c͹2!oSxG7xHM^)DR`ܺy?VX=^Z[1 e[G9ts8YlHt#Â{~ =sLPM v& p[:Bڠl4'AoG,JXлuAY\s3v~'!\t@G0`ݴFi#ĉ3[[cG8<^=jNHa\jchqЀ` q Ĺ 8I;w˸PK/an[u VG:6Pnިc5v*\ṳ|9WNA mbCtn9>)r3d#C$!Y~kzLUW*&C<KmZDJ#3*E@̋A6䦵sјtq-BLCz/͉b7ؖ%9IDH}:/=e9-idr)?c<}ZďN?zyDga'LhƄ0ѹEDqDh^1l!9-aaG>C8͵,E5ރ]y90)Kib  0^+8b'"J\k2R`WjI=c)u:<7m"}Q̭y y vRI8`->/Q鶰Hµ.#HQj3r)SsHTj9@4F# Vd#Ijeo^,5V+c֠%S|Y7]a86SZ_BWIts-  vd“bJǓ.!рD@HPP?( j8@c>j0QL}`yꀕ'"ynRGt$;hNW}z{d Kگ[։b‘nӌ##YW34=̾iPn_pq푹68 82ˆz#qH@#]P +E thtsE"C9HP>ᛗ!.֥ peK.xD92\Gt$X!N8u4Tf>``H ay%Xn:bQɸfw7*nuQHQN7A3 f#j #TEmk i㨌W1~X qry ʫ0#NP^NpdGBn^:#Hc,5 Y}h .=GX3pJ R8GK9a;5_mw@1a ']u0L7+܅'4뷰J/O.o֮\f^l>XTtOX7J*$WMdSsJ+npr%svvX,+[@Ū"V}o87u7fwU)or{ڠ f#Y7*YK9XOܙiGEQRĝv[eӪmEь3?XG#.&P9E 8R D=tBj1?gܵsme;u E' \A u)S#AaM<5:U]3-&)N3m~ΔuUbz=NmPn䑰f#9fY^AϙHn+Ee~X35E)I?]<Ψ)BAn4)Q98T4E=걦tΝhrMvS?Xwǚ"R8G$X]$]>sg>ʎ̨"=(hqk8c5ؽl1!NM6?4q6?q*]W qygMҠ fڈMF&{Mڠ#b$ N? " Ј#Nݏ'ü{qZ$5A ;,QE`9r 4WҀFB#;W9 5M7ȓuـOD~ ] 4"Uz.p$ANFB#PWmn{nw±{iG3S]ѴBh~UXq"֌5Ĺ)g 83K4j u-xpbyk8cVp:.mf ~isM 86;?&)¥=LFݨUIfheul1I1ќ1J cZ 6aYj;g4,m~\-`L0 cEw⌊ ŘS#A%@7`W1QZ%Meik3 'e䤌Xq"֌52Ĺ)g88wDu*TwC9hr9x`- c˧j4s76~3d1NĚb \8G-c]5yrc<=VXZV, p gتbX2n)6X:R2n,ipg@6FXZnyaXOձvcKEOձv܂ fH[ { cRڿzVy$ixF=Bv=FEzFJ$$r$&c2l ܌Nvx!L+h;ʠ.5|6p%B3΢'78 EKc9{*ux D5 Ƃ+|ɹjqv~wձt9Xf$zzuPI7=6Ӎr eN=pxP#:0>l7آ1Fj6gn-Jy$a֚>߶o`FrKHK DHZsb)8k] @هDő_7`Efstق.97ue.yW+|fi.Ks,&2@56v{ CAϋH@aTc+EF5?,K&m U|{ooh%p@O d@QXr p$2z4`Q?bn d}5ZcX`Xa%tD)H1Ρ`)t9X U}.[ðMn1i7ubMc5G4y)ip3 )hr\if>q2j.ʅ"Z\F;(ˊjy!}A8.˹`'d7P^d(F7TL Л̈U׬wƆ0ka*ך^`ʁ`WVI0 HYJ эh,YsiٿȚiZh j0,8-&ǸӶ懦懣?U%⊡g֙[?b" ^P_4+ :+Fڹ"㿸ں+4;#zSMd`."C9HP1鯇o^2Sc8wq@fX]bK#:b&{"œk Its I #D(wqꖺX{4\73]MxYW`I5p&-O;Z.-&˥:k~[.e]UF*Ҝ|#g S?h8>ԁyG7n,fn!hkqUX=OĀ endstream endobj 365 0 obj <> stream x]]6r7p.Z7) obؠ.z셑&i.6 %gHɋb3# 9ǧ߿ܾӗ/O??/7_m}~cMJ0{+[}7_޾+C<Գɻ4δx\ճc̮Iozoo߼ls2Y}N`ޱqkʘźB7\=)'\= w͞:[)e[js7ESbaoniu榜Z[!޾˟o}( B/۟|Jo}w*e!>Ż}X0.E6WӄUfbG$s<$7qv؞|CgLo`t\z@-_U+i<vL T`UĤU9DRWS] /`S#Lؔ7%JT g 4*-N$(ɆM"LAZnIze *3Ib=QE3ϒd@X9R4NB$0CqHѲ i`mk'p͘W8IC`P8_`%dUŃ0M +E |d*KtWOJ!8#nȅ!&d(Rj侔VU[w/ d> 0 -L J;ڰtxnbm5RP|h_T);)d4HKPÕdTxG|Ls{;E2 QR9.]%Ӫd(Iy;Fo0%_;{b|>Q5~L=Nb<!E[^pԮrY&p<S5CaI3QHPlXE03aa6b30ђt (k8Rf=ٴeyoK0βl%?sZ05r)].Q+SZjʨ buq Ž爸81F׬mF&{Ι̘2))3aLcK~Lgo9۰jzXd]_wΟ.+/bˀ F#J59Բ*z){(&d6N>-ɠmڶ;hl( lUŏg-̆,l*H7qEc+m ӎB`k[^4<'g"iDą]O3 XH(Jq/4bwLT8gJ'+NNBZ`8'KVR^ "tNEwK 1aJb\)Vlx cײt鈱Bq Q:5iW!W0^YK-9 ?S)˸ĤD\I#PQa"+D$gQf&+\yML"{N̘WQrb7CkA$q w%B2^əU +/%]Qb@cpÄp\ۆnoװ`t k;^D׊Da!Z#-AJ.3}VBNYwSxoK~6D)ĥ[Ҁ_Ҁ$(o0bw<|3U1]*!2~D #g菳q6KoB5eJh ӛcdO;s+i/J<ԗC7(yۖ@l6Ñ v9: wC0)M@eI'nc6e=9ԱCQ|n נ6-52"/<~StIBIJHKb 5!1X@j`I$U#/ ||  e$3UgWu2x9Y4M*u)U.m$(=*e)镛+siꓮ׆skժt^hbUUNxUn.mSooc'<9*"*u9nԺjAB])ZW:|B] 32k mμ5ۖ?kNU]edFot!ChUcifqNj8"|*gG)Ͼ܉ &S};qwr6Kr,u D5U8T.G'QJļjj=`vBUzހK^.AmvjPWfZzNB((vu<O')֞ywkP=~zWCb@lEBBIUq);#D IO?Ti%/ &(Ԕ?qr6KR~V_!eqWj;ږtN?k^[5Dt0W)PmC8PmC.n݇h;%y2N-!ͷsfNyy[./cbuy-)/O.@hc^}Ǘ3$ < י9qש?O; P\ܵg*2er˔l!*W^eZUƗH~;#D IO~T1S~`nT g 4ܮ*)vU4K27 /wKnTi=auX{\hbJuu8ouE{%| 5 ?n(>ʫW΢P4F/mPz_LB`:dTP)>qX" J65q5.6&n!v0mlj %DOU+E<>Ye94Aijf{UCip^ϯ?Urv?Nz,/\a?&7`a `uL{"0SnđW-G7Snf!7r{bIa-z(6R fp鬟epP°TO#ɏj:Ulϻl#'Cksv) ]B3nhxF XQz2 f9Yb0TXOƶNֽɮI] ΁VLwm5pC=tn13:‰,qNjс^omJI9.ܞ)>jӺxs'!ؿ,\JjVO,4 I?+EU"|O#. od4\2=WÓb 33qTR/fIJb);.^[U@,Wv_׾N=7f)JAԃD.{aT.w_O'OJD;'aT⺚H=ª#!i |W=ȧ]ºk6|P|:_Mz|5ըD(*'<2S,ȺPT&LdƙdWAșLTr6K~)v+w.sv/[ع|F#zI&N^B,c pz>ظl[b12voCgRSwoOMW,Y[>k`k`ےrQJ8559Pn:J6> stream x]ݯ7?ÇO˯?}y.^zxsWBs}ц,]>+r_}|OSA%i NdwzFVB+[~dEX!Np}ސ uYߖRWRZ~]ۺ<}S2v]%bz&= z7LraiZQȨZ NbжwÜ4nHIESO'ig4,IF\ eY<Qv\LcƉ6{Qr2bf‹"ȷA/hfE"q9Lycwdn<9zxZJtM8Fd5AH.6k&ژr($-6m^F}0܍\6@0ְSJª}$@Q &M"Ë#K!Y…vn2Ywvv-%Y*53yVtA-CvuY286sԂQbe<gгPsg,~"]$Bwɱbxs0oߜ}UD5yc.M2p5-"i:wrݙ+\ꆳArk.홖8˭EH*B3O׸; IK ya AEvYwLnЕ<_~^)5jT].c==hi*ʾ_CX1vleFk瞸OW5ЩQ?QMr(-XMxT#f:QZ5?Sq~Σҭxͻ ,xbc:M'|<Ȫl/,S"l/, ܮ!iD,k‹SEjy.HݜHGLƟ$݌zP+jQ;qhE1yy ްNe֕5::]ֺm^?)elKѝbG6F>8`qeB"nHݫH3s7insT""}4:zȚgEL^ E#㋖5WN#ut{"J8OHiA6ֺLUohI[ F<)ROئ.G%ee8%|u n)t*L]v@UoS>VE6 F>E<Dӆ󁲰[V2TVפ͋Dm&@*%u}knT|6CuzufRRWDHn EN1e#>|08 AX!p`{vO Gn[wU+!=c'>A h|b 7g̔_\, wN<^-A:BQ.QI[az i=B[(׆0KcyxP`E(MFuxnf?LPZjգSN59wxh͔x"]muyvvr %/1= \j qewDS1|]M}"~܍| X㮷{ˈ&6>G(2o AONUdD޼:i THwA?$42G=NUc3BI%V$)?,H &UJ"ĕ<힛h{&k2>u6$uD s NDpK+'>J׭dI}H8SķW̗8;S<ƬMMxۢi{g V<wf)ցrSe)wEh7%SlNԁ *W*T*]YW$7F0$ɰ!3$M' +Ĕ'tMSܔ\+;TPS`[PWq5lL@M?%5횣c55CEganF;gгѺk@rUQ00]hDMǗgՐcvm/~λuٵ ~pNC{y2$X'1I_y#'w5ՆyN~<8$|w`# #A!Aa4m2,+.(UEe35J@epLe<ڥ9lL* =94)J(@â2<,k0 /RT{\ =@9zvιWX<[Z]=i[+X?c]`xA\;q!l<6ٽtqENYBY ]_V#XOV7J~8[Y, $H"<9D5$*E]~ZT]ޒN"?&wtbS Tq ~s[-<9`2Q䯛ژeՂ ` ,7D1=@m=b"6=4!}`S.^R|n4E; l<262\0d9!ge,B^m$/877t}9O SSM2JC| 487* 8 g }@jar5QBƄL!|&+}F!c"pTzBFF C+3ZȘ)608S2E!#rU~z v*MSȘq~];-vqh!#N2=cBJT ]w .)sx5(dPLJ&_pMŭ1?ַ~9i;S@iʌV@htIe&Km>&>4A6ħ<X#vqOgc06;v llL$٘+]pV  l@Ocvq?$l `O3 ݬDS0b*l̸cJJ^ Ps >tKȺ\`n<~g6YhocS> ]޻+0J(QQ i`1!*m_Il'—9t}3 f> x:TU VjhƧOѧy-d7@nnʁO96t&X$u#)<c)`.H( XBY%dD@]{$06Lt3+΁Hm'(rũ(B)g'zCYў:TRqg(Hh7brb\CzڸoEym ɼ X*n (u=NȆ?iٯ@Lm@f E1K &jYt#Nθ;4kӪxuXܯm ͜ G{`eN",s9!D{U ɜlkT_7= p^)Exb0L4$`[6DZ AQik( $ +Pmk8 endstream endobj 367 0 obj <> stream x]K7r 8Ki`~{ d1 cc;^=C6Y|ND#kbx> ƹ:iKn oHSA%x՝έx1hB毷'g*c9!eiwyQѺ,:t|IRqW%yO1C1͡TحpwA"ܤ`7#A?}'nڨ07r ӟ޾ۧ?>L|˗a|{_'~䐪:iifb(%Ө yU=WМPMo}S /ڽW=v` K99 y)f^_1ׅJ{0县Ovx5 "@M_xe0Yk$N]7vSivYՑ0}!G,A7PQqh>~j^VC 0)UCDSRWter e%uw:l3|Q|zL>-s QrdBۉIՌC9\ OlpMH{P%}}[eW1w1c;]лx%Og*>WJ)Ԍfݷ2$>Vq14ɾ0Z`CCavaI^8(d0+)g $WW˧ϼ`Tdf [Ip> yڋXZ*q\JJl89 v@taJ36@I2 NJBX?&inlWPhU{I}5yV>U&eΗq :>E 8FQ"9a gINӳjyDK]{CB\fs;oRz sPkm4Laӌ+9 3\9s>nƔܯS7t@ug}5E϶nlΧ2Ƨ3aΧYÔO&%3 6TL,Rn$ L#N4ήtdI#W5[vFkZL\]XJ8H@ii'e7K|Q Ieg AÜ)g%3OJfɏgt}N~,Ɉ<OJBXҚƝX6˴QO*?&Oz ARC5l 3>X&Riӓ\- U(Wm)GzɳHk&J9 ㎢Q^zFJp7a< x:uNmu fUqQTdo26TSy0ʳȚAr.1rEijZ0y>,dȂ5YAZȐ4"ҿ6Y9H$^.> D?)"ⒽxrJקArү&dEu#!i,|YW*^`= ]y[N)@f6P>e{>uIvx!_/_K>vbHf?7):l_.nǐ'?;$SoQfq S^QvfS1Y@ pU]D|4D: %hiCu=r]sɰf t = /TbU}Yo#`n {scѴ٦W.پ,q˅ٌ$m+_ ,l\錣$슨v=(f=fU&Uopsp8 L+qYfgmÛ j4O7o:ݤnHw䛔 Y9 9ْ'")'{=RH{GcR"M/PQg:omffա0"pXAwyyVMslހI!C!~UjyKh>hGq C[4Ěbmsj|=OVK԰kz.@װ=j~X`%Ċb=(f=fU&Uo֔l..gH $!lZr L%F45F;2SAjB͢*a#A/oJzN}Хz]sdkAԧ 87jQmWH-AaŲh2HTL %)V?],):̪g%*V?EC!H9He6_~] M(fv ` o64=A!$sP1L[RW}lp~}&=:Xf}"#. 4 1;EaELx"_-.N.d>tr"uS(eTT'G-W?9C#֩8 GYIta/[V_Oj>O,ngYP[քv:#A-t :!ȉ_Nb4f:~\Z Un\0a#L BVu- ]PY1p"cG-1ȣ-@Y(ᘢ1 Z pDS"%U#EqѨL]qxi8D@|S}OR#IꬊϤZ͟c) UP<ߞTS@SMZ1u3+CDRD-A݀Cϩ5^]0)A 5koW9( MO݇́lIcZizǶ1g ՞LRY,=Ͷ4#ӗ5 U˾Ƹ_V5;HwmdrSg)Pnwɸ􆘭׎9Qw ܴvd߶M[.tZ;>d@.Ƃ$$$Ԡ$ PUɢgySׁu2""Rt@) Mͧ[Zb]C{bVqhy59Vn;ԑ''y >ِg?e5 'CB1h4Z7F}jtL+ug! N]!\`[ ,!^Ҩ='aJ<=m qڸf)̨NB]@,uoB/a,B ?v= ФPPR( (UxP5y3PD\)E %.\^Ph۠Ԇ,޸ERuE)gFS0~yTF[ih4؟ Z͚Fmh0ݡQEzfB h Z9*)ēUg$fX++aµ M@%*fxDcR2wuj@0V!FĂFFAJ*QTpWjJ!sM4+ȒFSiAF3t(A5ܸEOnhԺizGF_avE[apjBW[PӚF.!լiTF;4yLᶝA򺭄 h(6= 9to% M͗C |uJC_fx i;~yH%I@Ă@@AJ* PTUbBՌ@ck{9,S_K1x #aI8'sXQs X".Q47o/D endstream endobj 368 0 obj <> stream x][7~7p0 ӧ{`by2I6WuS=bX$T#)J_~oO>^}o~㟿_o~|ݟ./o||{7B¹ڈhK6._ o~"Bީ]3?馅v|;ʊcwϺ+xgڟ~!A<ݟnF\wO LjޘM-+YqY]'Ö4h զmlJvwpf#"#_? .1wJqI+KovFw tv^3K,F٦l6]||y'䣎3YQT7`=~E;_c(:lnEd0 $w7נd5' s6l@'%ܬ؋G)p' nݢG{0VgX3e6ܴ DN.S?$ь!Չn(o?*1&)O@rp~ĄiA9 zC.2`6 ̦@  j!-Qt!;Yr&=MЋQ`VRTPe=adpdVpSNǴ^#QQ=Lml&e&0¤aRqRf+2կQ58M\'B#nȝd@m|fFrD[_ޟg~tgF_+G3`g_ZcNAlNa'0X8Ei"8ak1FΓ~XgksE ʜtF@zw@pu T\KۖrA"EQ&| "GQEdq5j4ܹҫ+ܥÔyiFL{0B{X beCC8i='i}JNZ0ɦW91zur"DF+@;Dtiı⴮<+;$=N=X bwYYDI,nqB t(f$W#! dsľp qӠ&E?b6 3O~`=jEV'A*;o’ͼJ+.@`- b{X,`5;mH!q' ~^Q0׊ d3A!+LP-`b{9bc2U@<ҷv[}^SS5vxxPLrM%QVM9ax~ %P%'ᤰ-N*63^/q dsIo'% ᤲ{ZZB(q]IT}dR/q2ԅ%)NJQdNJ&RȠ~r rffڸ-/+~ʵɑkNN][4%Nfᤴ b;8ٚFr𭊾PKM5ss )[}5 8yʹvpd"N|Eɂ& pVnQ$*Sƪ|cAϖbJ4A:uҽ| )w9P*^q N*"I-k$7K^P:d7i&P\)-;eSR҇@9q`d JW0<ʴ3Z`%yX([l:{Qbx F?WM*Prׂ#502:vZA+2IsLRя]() p,<422H`%8(F(L aP,{Բoz\e'xAQ}+uET=ENQ7=FcKf+L<Aq’ `|`eRA!`e諯"Οtgr`5Łkg-̑ш oghd866&+WmYATee3߶eMO9WwQYЃd,{q eؔf Q!UrNI!N Nds4p NZ&IwUVy'ҽ'zms}BKC/g,L / xiE CؾfkwjI]* @p毒@09lִЂ4ݴ&eJXnѦ-~!g {W<_JHu5ZF  lP V(QV}2VC 7FF{3^3-gxܸN>T.Ro?z3d͒lmQ 7QZgn4 -ni傌`([1a3 3p* M1tqi#֧<@)W,EcG c)zaIA1E6hX5;(8fF5`N+hF[ 3i)Eu a 4TXpB!11Шf# ,&l.}U=|aarA;'ԅ=/xGx`r7E9?Oaİ<O^pM >awv|bn N֣q{ : l?98SU9@Bf>{|a H;gZ?:p&zp(,wPϝnֿ>NJ){Q7S@r<_f]w0Cڧ'lK-|T%x_QYJm.vFVíQ6:?\N ^Z&fd6ey8Ք1A@Dɸx'`h-6AΧ,zGk7]墒?ZVS+fUw;+ k$`gV" %f=jP ]x$ԘSc#4o 5R_.M cWН'նZL]]M.WdxӪJ7Ԣ{wrb-I[n "ln H' ڟkLˮI 3WdtLi ZHF^؀hpR2Z^Ew+شԫ0rs:zx%j^Qe~PSk/|8H<`G穱k""*pٱw,r! C; 8=dg@lQq̚W2k!&L'ax(4n<| ^x~6T<,N(ċIJ~8f'cP8 DXjU`$CBbw`;bL,nH,ɝ< .7R{{3&UaR¤`JYR ϓJC+LJ\H*= yOVcJM`O/|״4򮨐h]@{ZqFVHGTGu &y0 [QN9rV߀Xz(oN4*$j0]0e5@160tO|I>B& wpٱl&zzC5"XM(DY 8Q\'ϊ4 PuzwGɸ5iQMB[Y{ܚNk2}^̸Bgkh-:=M? )ޏAt2@8bs8:l/2::f,GgJˑ3G.9pGp,s){ѥ^L^/83z:7];Α`ogLlѲ<}`4iYŎZ{ Ū֌o]vsuE) TEQ%JjÙȶ] [>3>U}]deǺ UUa(xW9~L+#V|R'm[QFZw+>E`ԛ12Ny E >bT L'o&Jlg U!Z>0ЅS/i+rscD+.PJ7̓uCId;ʬ, @@3UA=Iʲ`[1хVsoea:ygʭE ۇlMgc Ra; ؎NKQʽ* *LO5 ޠ18XclX3>XGVX'V vs @D0lH4+-L'89B8NfKfB27td;YQpbu&aq[ Uy#[{ p1O5N];ʸl|IL Yy(i_UQ2)T܇(ߏsQHt5y#D\Jtd'Dd}KHki,;ͲTAŠy\3km auJdTpfB6wB6.ec KWO 0_#hhcHpZ2Jcp)S v6$gD@9c #+$g]!~'6l0Wv/28E=ZS-)1cmHI_ Z E^`xHEoDvPӘ ri3PV:uX *-v q*ĉwӧ]K^6D8K^K^@0#A]( h)]B|Tq,Fv5 V벯@؛ח)5+b,jQ:IaJ:ZGd5uj\cpF.i&fפJ^2ef=`5AKiʕxk,w"ʻ˥`˵i>OPiY󫾊'3<7Q"Sd魋ۇs@G =!9P\0nܩ9Tx[#VR*-_ `;g0gP>7%,#؝"½ےpd].0VopFGqm >t(2&@+A Yaej\YibTNP0 'X 5)| cYX>IdΥc[DEU$v}}T\Yvf`zPr%g=xuHPk XƀpRk9*>|PUy$iO+GqB^iV:t!wb4_NU $Uu\vVu۽ Qݘ9-m=;@zPLa@@`@ P  =>^‰`hV9өYz:m# hbV8)ԍ D&/QsRQ(”_{K\}ͼN]_>kz:RO31ԚWHoJ+TNNjf.Q er}+Mq^'ON z۵Lg{#FhssxPkSaU^ | E CxKN΀]zW8G0ѽbd9yQ9v/FJm;mKd2Ad ౦+,!:RX' .:Tv=pm?Bm~yDMs (,KUOU˪¸85<ZS,Fxy'c&-\`9rb )t @DVshyh`5dKNl{R"RnyݾG4\)7qVnŢA$f-Λ;2ӣq$3kR{l%dv0ErwHDrz"Y eVjk\',UZ,ͽw1A>;Wj&BE|멊 UYlv r].OB2.mb\vo56-d65J쿙YBDuqlP9x򠘄Txʎ ..0D cӌN|X~`ժYUcX&DV U1U0#?\ BUpը4_ X?~Ct5&+ n㒖Us̖sEt]{RZMk'~@K-1w=;i\ZOmG@wr|U‰)zTø:Ku9v>;u3c`~DM#<Ч 5ze~ntvc q8Xu16!>huifjl{J` PAXD0 (=?WH>"$n|o6ڇ/_Y endstream endobj 369 0 obj <> stream x][}0Rx| A^?Ď Kvؼ32XtuU<߿￞>|x>Ͽ||xܮ˧ׯɞ>=?z\-D% gO|~ׯ> BިM\_Q"ٍ޸WCWrf?Ngj3 sB7;oy[(]J-d:>Pq&Yc^.zfQ*w씸wd!VbNEl!_O_BI6$X,zO_}/^~bc=frqbu"o(QE/ZoIۺ:xzW_~;`,鵅ns jb+˔(m@ x>(R­3&3.jfF>J0*mPyx\ "n2A?2?vB̍Ie2kx{ mLȅjPѲήv`]>v:E V2~f 1BnM}0_i?{k4&w0=n/"$[8cbrQ<6c7:ܬՍ[QJ'J6bw>>ztb),\a,9w(1^ ErEt-q$nN)i 488!^_X>*Cc FGVvqO?qGWrX~2آu_LF nj;ڔIp-i "nEOr?cZi;} z$6[[Д]7|67hcvkD+ lف%5ZSpcd`^j`.\c &D30N6A9q.OP0F/`1ch1|7V?F8H 3+7-}ЁuJ F}ؙ*HX1r0ig6ڸ}nB4@?Dӆ򇁳 g{`rqRP1\Njӂ;#g5B-gO[9<8ƨaMtKy40xi9Lfy`¨?2d8A(zcہPn#|2ߥAEMS\{x&jCW(2QLeP-H:\` 3q3Eq&YMQ)R7U #zٙĜ=]Ōܤn&1G*O7̏i7=mc^(w_k~|GهIz(AvvVn\z1 aWAppLN`s~($]y# R:oԴ 5`Cis/v#AhM 7(ǁ%>4lA= E $M;g2D%Uݶj8[Єo* =bAndIQEs2{ 2 g5tI#(ƨGF]s'LQmT/v{[u+Yq9!Ad]ī3*K)"gԋdfjʺ!Ni;?Kti*^/gn )QpVNpHi+Ǣ="O7]lqςl9T0X!bh(y8Gi?K J+3HڌzLxl)wוi"pֲJ}AS1lRȰ0f6tf٥+MK]?ikINTͨ=i|1%; SeZrf\ nM6C'͹-LjIP%5>`S7m2q:NU &VfpħsԼQӧe JkRZPҧQInzU^^׽H!."Xf])|0BdƌV˜Jw  7REpZ"9H9-cZCj+'X6Oj|m~l y@mkC3AjJ 5%- OTUΦbOv@ChܐrjfDAqSȚ)b _աiymlD^q_ dLPO{u-(u]Jݝ~@GYCV 0AgxmjrFr^|xIsH"¤yr5@0kia3RՐ:,-M:fDiiILp6}6Jdrd0y.GMg0 ,kOy7 h8}NXSZ0?@'$ :Y5&?uГI팲xlO~]Lr`rrz r))R4 d%%OJ) ]rD23A.zu$ "¢yQ=8RoFkN"Yl^:zp1{=FRZ^ p-L3cəT%/rӝwn+U^:Os(7aNQOp:'5' 9Csz3fa~rl&1GRDLgT(bVؚKU4;PA[4fe?^wnE"zǔlaU J`8ESֹ|y`UYLvz=]MoNoB\`9;+gZ{3Vi'2r}<;EfuD;f2nQYwb!o[g$l9"=*<)"^o,~ˀ?8edl/Otj9pw9z#{ *Gh}~, zq\xh3^E}*Mbޠ] ި ޭSG$].sعD: 7o wNEfQewsw}ZCLbPOWN=Q ǁ(pT)y`t }NZZK}U"[v-p$||Y$ ki.MDLíSj|*nU&57^ᗞqO?>C#_珥(nE=8z0U(FUn]px臼Qf*ͤ2q:Ь2`d& Wyes rYrpM 3[|W㞕 *01GE*TSvv/PTXd*yEX1k+pURn-*;hXdDG<|[Eg@'g׃AB'B6e3I zF"г ݻ2|8`hajLQ⟫ ooN~w97f7̹^YδEE1k;d嚂GJ?\,m]%m7_BhS4ZIBY}\X#7 ZMTa`DXb@X"Lx|k)L[WfGWGG>o3MS`τy R'S]CMw5Sэ,] ɱn:17:ϥ*X(乔xT.%=~DmeGy&e8* `Hd&qTs lGf1$MsopاqrYT[ymY3g[Uf%1"wNWPӍ' ў6M st$֡׼`=8EİB"N^pۍo}[9;pb~?og^H 83Re~{9F3nzjPJ2 F*nqq8 t]f&bPIA V Bڌ1:U͊C6*<O&{Q"khUFz+S" hۿo=}a T28=잤KV2%ɉogs_Ekfƍ7ҺA)Qg//ՐQh g.6rVfNՐiF]w`# -oX70.]@hl^^`׃P [7>k=`8m:bR(&gQ|kQjC"M FLzR86(f]h7SC,lNnm8~IЯ[W`ˆ2%TD|% `"l͢n}{q/PW*?l!5(AN穉x'&?Bkm\*qdu8^ЭnB5+X :PTDskB" tDmuu~]Nntt5?zdr(R&&!ЃD6*mlsNjmd/Lk~* mӾXo%G(SkwyլY)ww odH], B+CX7 LRW.=ń6) `66OZwBK c-kSsekz[*f7œqyX}~[Il5+ ȏ-Xan0ڢ|*ˆW)Xzwx{ljY33<_ GWkmkpU7{`bSv|YX@OJG.f[1lS;zPʵCM*{!z=('iT]RPJ*<)0bcT3g&*Ni|k;MDcg2Gd|?8dѡqܰ$KsX!Bpx]wu]ud[t מ/ 묘?qYyzzH98~ $ۤ){lijIC .E@\qKAFU3tvABr"].:ѢwHFI?UɣNBE Ј:sȇG-IЙ.o _0>s&͢!{.I;Sz=RFSOj<}FaHeC)'2GV м"$љ`xo'MSWpjxdKrŠNFov c3F&XCM(E_ iǚ~ d:4u$Y\q2M}hEnl6]c>o{o}_(3/o̝X˅IG?P~}&07ELuEf~mH ԙ]고kT}sZU 2Tr v#}0:Vxny#3_;YaÄK=VM#uHakfg19Sin9X_ӎ;AYNB7>No@m?ؘ 6h?=g<^r6!.n7]A|7' <,`*uUABJ&n!QXu&$;_ Zdl |}rA15!=hA wU ? vˮɬ9C{Aセ M mn hz56hHSX. endstream endobj 370 0 obj <> stream x][d~o/ ݋(*3]lq}h0xdz~= +)tt㮬:RD$ŧ[_/Ͽ_|_ӏ_\ϯb/_?z\mD_%g\~wߞw*$wv7-gN;%[q3h{#|TuR'ڸ}>~RGc-6Y(iSxYO*$fQ$7Ra̔z|"sVn]`acth.ˆ^ȦCwxOg&ܿtB;ED]Jt5Z{]w/M?Փ0k1ĽP%7c/JlB%P_1CdG(k氨J%XWó%wde<V,fڴ"V];讠l2ߞY#CyƄظ2Uzu7=px?ݮJ WԼHanr#'rJ\/DzsdWe]b댶ZŘ'WFDWF [ڃj/+;?(~] ahD u8ckfGno4gnxB\Lv߈NzM]4jnpozw Pj4ob}R?h bD,Gf\s/I;)Uv:E&\;GEQDzEq1SDžxo#aV%>XFeB@ bSHj*02>Z c4&fT`y\ʘ)A^`\ѫRrwav+3l [FU7qܟ΢:P3SaȌ"D at2; D#ʺ2X#՝)kG)DC(y4eR8:̔*B4umJPf\N326p7*++VYƠA a,8Ϊ@!ΐ +3u MsqP씧8H!4!v"P7XeEa 릕4WU@K'seaP7 >a 7McP`OP@ w a2 #!d!c~7"ૡ YpgPsx3/=جZ'MRPp{Tfrq2%lƅm?~?;NfF[_S\u)g"q@ne+!]ށ_{7N^?]kٲ;VNRI}"*NtQ0tLS\}Y,W,l7YB  #\JstXHؾ_>k$N]e/3?u#چS%"f(S˺[$Qn7l(TdveDf}yEqJU].;dgеtXa"$7QY(#+(§uJ e6,gvL.qĀ] ]uή_tϮ%|a|uN9W8^/ Cw+ R]G3J䒚 Vv/jk<ˈׅb )du&/`65Q: A>.Nb˯>nJ=fXO;T.hА: RL(jZXc5kiLo>b"PgiԯA&*6 xY)f2YqG S-#Z' oPDOd0p+d4c8l !-pb[qI`KJzYPI.]:LR4KIҔ.ME%5K jJrD(P9РSDʥks) |@\[tĐcb(1? 1S1#חjݱ4+[듵=K\3D`a`bjLŃbŕjlKDfzKNt- ]V#Y"mEv+zߧdYX[z]k(A/[Vѩ3nLj7uR x-~3ϞTD [YUq+VVf$N7KPG?V2;&0yg0b1;LY4'fIҔME% 5&f jJr,,^: DfOeeer9*rj{:WSKTW #,C#$%?VF4Q;lEmcOx(/ؤ5M4<,MUf|{bTnHx+F,' CvR (Q=5WH%%[3BGZt6_?$p;K%2C\@6o0\~ \@1K1 Pu@GOFۣDFx t筠 `@bpJH%-$ )-).H hz8rP﷣34@o wNQqPE`7R;q+JV՚D,}UnUS|8r)Ź\ 8G:7Kz?aǛb8KwzK/b |Ҕ|} bͱ7܆wiƈn+0](`xɻR0/Эh.yrl>AߓZ(.`NQ#ɸuSP6=20R d`nҳIxR$j<kĭ9Xӭ4= L lpp4B {NkpfQy{DnZp9Eb[wEI$i7Jfx%DMWrF+q! ˞XQd )}VHAYX~`aڽx4=FXX(t/ҡXopSw]„yzwu47暢Pmʛlmͪۯt4ƭu{cg!;-,jA*vk.֊pި]ˆ=ԃo;žK'Tۺڠ_ÚA)f= dKV=՞$@Føhǭ9Xu €YYk5r 2_w⽆Ec&1kla@ݲgN2 t4L̘)_;$\Tb6QCDZaՐ;YQfsZrtɰ&mR{C-4)["m.6UlYgƨ^)}yaΝð~l_6w#j!Q-,DtZe;8\osw|sl pFxւ 3p/,.Szwn.{2=y03 |=inLdf`=f6d)ff©v//YhU^GBgU=lir)M)n XY(C̄EIsV$MYTܨ1+QSV[5de*|Wr)U\ 쀐q 6ƺ1q# `@bphA#hgnBu(.ڐt< flGposh,8{'p,N/P J4@yH]V5@D.PV.PFX:V*2^ʥ ֱr):cԸ L-=3X gj̟k6fjg3ݿL ƚ3k=H#־?#0"h[*,VπK43;8[ߩbSv.匵gM?3Icz(襘yI!yIcٓLG֍ Icdd#(nȫL nLSŝMudN1I2ޞ[N6 Ax{8 B12%`4%SQ6 )̭ fGd(2$>,dipM7:L2d4M6ٲ<]\˦Ds aM1b{^6hÐa bi@ͥ,lS͝kX?#e?--_d=n-xB@0K1+W 5ýMɤɄL֍DPc$0 RUBmBrNo9MJ6ϦJl-08v'w%l,3fc iI366xKfԐ%Q36VX5dcNjV`zr;|'URkp)6ǔ #,),Sk@%J&3SJ&][ods gHV{4 CzZYӪJ5´jiL5Y;]nrX09,̺{BT{*nZ?c;3 R Upog,{2=y&Suc"=;k/Hz zS-sGt󸥩-Mu˖&ןYwrgpM6z2m=++$DVVYYTQ&*XTT"/Q@q2: (Ȏ5TdFKR52=H1!! pB˴PovpvJȄ B]cv-1kݼzS`!!-,f]̀KYwg;k=rhݺp~ 0l0J1 *CVߪ7f3q]8aWYPJt[Py7S<=:=KI=;KgbA!iv.*Q̨$jvjt?8&F!1JE(2 FA &'1BB12}["Fݸ#&gW7m{ gRUm/uEaH0@K1 V+RJU;ŖCJMT&*"m$6WźSH*Fp/Ŭ^x ݪ'ړ'79iTWI/MH"fqRH@4ήLqg#qFlЫOmeA<6C d#3HIt#q**01D5H̭n$;x3)% RÐv2IHfbQ[N[6u>SЖmՠ:U/W2˵nA][]+ޮRN͢=Is[:`?;nf_/7_Yq93g $<16^Fha\g5ݏ?\>|?clR\ߊF>ebj=-8vIWrwcw"7޹_(}u;no0Ǧ;OxϹ# LDKk?Wvvy˳k27 *g&TP)^o J {\ z}!P#'WEpsk޹7C@s/w<57`L ѦN"z.a(ҟ_Y #z٩6bes6|a]Nt[v9r./[ɍ6UbtYMBSqj+y7bµ Ѕ9 cs}oU q஠4ΰMJeҡeZUK3U(p=Cd[Luw8!?ћ}Ep2iQ۹VgB7xGO JdL7jnKv.ҹΕ+y窴Ib2ؕ0l?ؽ?|Yhew~7-]dE>i*^BfiE&pGHm:П ڳ4Mr{IvQqOt,~=ٍzAQ. 4H]Sx+ z9_(Q1h9鐞f *mĮ(G))MX)PՌ#nʜ~{](565E-o5ΏCu{sRd{IJ& e; g\.Q~Mc%> stream x].7r07V1˙]rB.^ǻًwCȷt.Jjb;zJ%ߥ֯5_O=|~~׿ϟˏ__O?G?Xf׿~/?rˋvzQ/=oKo]_Z̋~{Jmz4?>| iιf1]Qot!um;ڷo^V_=~zں-C|nj_˾ܜyܔy???,7ywm;L?㇇/{~Lӯ_9LosCCj}hEGtOʾ|AASyep!L=_vNg^qUZ[m\ofc1{hO 46.|7?'[ݖu6rnJ8JoR|Á^5C6'qȖ>mgd]'޵\w`w3E^br!]qu9iL_tX *= .nuZz©zm34\P\zqp{0noRƒz@ bfj󦟾z5X3L&B[hb;z 9Sp?y G x6ڸxJnP|?[V6aq'7jʗ#2a;oj:ZzAE%y7~0V&Dݠ]Gº}?7I;}(EZHȓP^Km7iǽ5g:yڲ!☳)]5rBG%Bk 3k E锏/1tYzYDQ=lPeu rgdӪMQ1Ր4 ,k&,證tCTK cd"%⿼дUzNV֝2p+W&)kR׃yg0nہONpk%D."rczL+fTF5@Z^aM6z\%?8l䧖b"m\m=kFh`6 YQ.SLckb[\ LmL c;;C.O_&_qqKQƽ{f.GAs_UC900fO)U;cGw 3Q{GC|w)YYBaM6*l*\[s>u'6Դ.d  ]:ܒ~ߕGPJWVusLGGM`g 9fWNj 7VǁfãAr˗No'.'if#$zoX@b~zh&;rأ ڷ}66p >8#RP37")$@fpq(~cbyl<${!]*QH~Be k=R^]b'YjP`0v<wlgiT%KG͵)B^-,C6ήVݽͲ|64Z"xv9?w7OWKxʲ5p ([4߱ t[0ְ5h bHhJAb"ŋ(*(\3!x{RYrg*^ߧb -)le13bxekiZDSzXȀqSvfRlj|3:g,Z}͆&26\)WEHX^b[V50fT# 1*taH@ yx]4lhڊ 6"F9nv7} 4kh4͔H5DpgDZD:5:  xG<~oXs@ҕT MqlNcI!MmHSJЪAϚ,E:.Ks <);`)RR䄧Hl f E>8$1ۛCH~LNI> gV8q#lt˞`leO0v'SƩpkP365C 9V'͊#]rJGD3j}Mxӧ Ū< i]LhHc-D-ܶ]! tSCTB&EDG"IM|F=qW~ r؞˫z I@FU*Q Bz (M;SO^ߧuΆ24)(RTEr2y?q4x@\w}-b&4F)]IqQ^EZE0].W%_]u!M^-bE4pEsk(Y}#6?Cl(jPTSA+K4#mh&8e(.E6DZD(*+,PV<^en:O 3y('r'Sb5>M֔("}[ ŒEGp#|[= gWҷbPTxruP*82߿Q\q wb:Tr/L `f[m$O##i]%tWT&rGIJ\6Z=$w%2fE""&VP^}DҲEBӵdDaOl,|xNB.ݧkMgqli iNk>6o }:,2}:s 9dFTVtdTEPXI BPH'WUp!L+U7U=1U:r%_Ϳ`plaClC O##i]}2\Ȕ B&)dZ }r˅B'YD)2}ox^wY@c8g]߫1M8g.X'LnYR&BK=2fI)0VʴեLR2̉oNjF45R7 (N'KYLRftO. E%lt)+aV.m(g^ 4r@JQ |Q3zWoT)PJ[]tƆ5 ?EG%#i*iTik`թQ^5RrB4Ny:._J-_bsz=˗Ά=H9GK#|"MJ oHf[B$^$`I 0Ke(K"K˘o iEH#%^ ; D0'+H76\=D.kHS"k7rXKHG*_*KٓP]IKbP/NP^/u*e|ӡC|`3 l×/~p%?8|OݷMO*_J\/d`XȾ._InV/HKƕ.aA4yd%_THus*r`CrX(QxQb1opxvQi& #Z j|$5,# A)BݿW#~$یdf)8S͕qt6`EHI oܶ&#Ra$cK$(Fb^&)A/74d5P}lT 0ʡJf4c6Sn  pΆ&&&ʿn<Դ pyx 1KSLË 8 `S~@"-CY" 8O-Ya6^; ࠗfxp.ݣ{Np15FL }/\I+B ?RPFʞ J*AWu*nUA;@*"1 LL5e&C,Ȉ~w']Wz꫓%9ϝf%6w!;VS~oW!xv_6@c'M(1f SS33t'>z-)ez|@'{0ٟKr^iMGMm~( ƩBCAq|:qx9'CY֜INEEamOEFY4H0 ̙r9rFX(z&2y#ޑE$SZFٚ/UGݬ mk1qcRF׾>pzڲ!BR#tXt)e%,*| >q_:w01 $7."&*mxhz@5T,V[Zi"ru\< 4H T0`Ux y =e2ȔT)]\_]]450sSA @vv59RltiE[Z+{_ԣ}VΪR~]?Œ ]\ZіH W+r1D{i3J% eH ~_2ooC?o+-{x[v%61xĠx *x Q%\qӡC> Xf ,Q:mtX5JH-O8Ԣ'Dq9݌y-NT8u N;$2x,͊xISf}Q  <SI=G0:尘)X'G)Y^P<%=Vb^AJX(Y['YIaTGS!,\h԰8P=v2ASʊy6ĶevQ*SqK,ȱJ\ܤ#csDr 爆rRA.l" z"91l+B fx:Wp45شLyxS`L3̉"&^$`I 2i|B54@f%&oen=ya&OSWQS66\"*L5Q͉_ڥB NrPH_n'+J N `BPu'+NPzW!++NLJ ETl6PD%QI~pd$?~gp![uR20zs&q_  *sf""2$Y-z!0'|U~QsD-c|n\<6yR=>wtqCcow !(#JmzM/]Z ̩﹝0'`'IjXdNQݦK+5kGTE14́Ou}`B0{ME9Ԕi$ħIAPʤ/2)l(|Pt: z(xV Iу2] `΋fR{LɟL*Y¶x8J^7U1nj49fl))٦O9{U5~XJlI[əs6};?A&+@,elg:viCmKtlrvBǘ. 1~Aa&N@ ՕK]٩ap[]\Yot])5{cײQ0donI_*dϨrâS%A~rF*JrJ,ג*`I(ג*?߿M Q\ZrLwN~bT - @mSm@m!Q~`dD?kd/yL+eZ`3PeW@|=^e5Mb"h ˴wc7)YAۃ )Ru,˖As{|1ۍ:SxO uYi.K0N]Vi&7}`.˚ cd413#*`43Xu}_l(+a!,)a55 2%-y1lSqplNLȸFBt 3Y ;!dY 6(圐2p ڳU~߈A.8|NPBz4l=/{(c EmXʜ.iĦ9ǯy.'Y!di&2)$(  }_-CY7]ZEl7MLjnbw ȓFQ`v5QTFӱWۊQ`RhjSj`7;0S)Xy)o 7:#{ʥR՗bUQTZ݁T(\T2  BTep{©;B C JxtevGګ=TJ!A !mf9EvZ񣆍 hcJ )+aHi dHzH=QaG #e5G $.yA48H HH\r|Hr䆆YG %j`o!5M>ߕF:ד`Is)a%h4N8ءI'CY;IIrb!R5KG:!0ioprfTB`0`%p!FZtqE@if*p ff%v3DߏP4"L)8Nv4s\>wDm!jci:0;_6 dHSq:ehs70 "ËHl ؠנ#%8 &XPBd"J$F!L7|P $?8;q;ѿ sڮJaC`3pؐ ˱gq͊%lcYbB UMƽS*9UvI9<ܛj,SKǂ V1$afhaAC,HjXfA*~fjCA$! 8J&9aO렠ΆpFAr2 BMFHД(b\fHA'4dT{s5 QuK?Q(PznʷBPC gO%re(t6U(tIK e(DMLhTl$B/ÀD e( 0kR3Y&45  [@Bނ ĻP$Xeċ e"w#Dh:Zk"t}"4XD(<@$$tXtPv#aIBɕ &!h({ؐTC@CrLwNgE9VD]BVF6`bC v꓇ 6%H5&H578(@s΁es 5^b粍Թd c ػl#.fluľeocVTM& endstream endobj 372 0 obj <> stream x}].9r}CYc5{=^cKǴcZ^*W7a̾hJX%LyZ?a͋^"߽|__T B??Ptb?\׋]3_?z:/,gP?~51c?X[ JK?[f,M**MVy$ug?[(%{ lpAeQZ&a*HU\{7^ W/o >H'`:2hXa&HA@U=8Ojg~hއ䦼!Agt^j`>؇2ebP%ئ47 iWΔd=f1- *.!NnԫwmY^$-A[o~4"q#oZx4 Ht~$Q:m$DHnRr8g{p$gIGntΑdA:1 sOMEI7-fH?vDNlDĞb#H-)D/ tBRt? Cj2V<\=sB\t+F(W|/;BW5"[JI* ٲeKWʵxrA~c0f!DxWzɠ&xm Aq0K" 6wf"i:sVzi*y}lԠ#*1rD-GFiR!'":WvW]N0W!RuibkhѠA*芷T:l8"Ҭ͸+y݉y1Rrvƅ6DOv ?/H&ȨqtGE1V-eA̜j{.t0}ao RIc{00 Hbmmi~w5~xx^V .VhW}cgַ:K#Ie@diDύ tTY#HV(+wa|{Z4;#3G L8Jˎ # %G]P-7vez`ƶ;=bwtLϱOjp#h+m$.'[ UugB6lN (TS|LQMj* P)@PG2;TSсQM#F[ܓL\f%s |D=Wy [y\lERPB+ҒzҒҒ2Fh^9RGW6#ur0C%IDߟmZ"EDiw*ߢCx0J!箭Y:H& BW wwAR@1y@j9*ur7VgH4r3M]ʝs֝†:JaNN/ݜ.u0;|⃳ 7؅3{HUGT@6-؎Z|w4RǓQwG'˶C)wpQdž~ 9;u)Dv<n1@s`}NQՕQǃT-&hK@q܊)eҏ80@q$ 8QGցRY Nq6PEFqdmMެdF̐1'܀c\)ly:A}Nh%@Z?-:nCg4NndH2g]>-7t,EhwN(@o h[ rp!/䜏'^`D2p8A$ 0@ub4fuv$^n0Lڱ l嫐2#<{c9>V-VkEd@&#c? 7c4ĉ?(X)[ zQ^0L caZdbvAntHkB}nsH{"HNўO`'bt4 y yxQ#E?r3H#J8HDő2vSLIғ FY[KZ0 P;gmD+YʩjO8IѤF>TŎH«ucUHB>(I FJ-)2x'2'u' g2lϪ(.u&Ih~|8x|[Y ІI/9cVk퓯8{x WkJEN[<'ͼצ<+y) bU*1ZuJtaR^^)1M+Zq@O蝕=C2+Ʈh؊[i(Qu7o}x:M׹cI)H[vʎWÎj26f}ěƬvM/g#3yvQ|d: ~!0ܴ.pS=%ml&\m|F YCd=|J!`И'_d KPiP=sm:&~R|u"3 >nBqYI w>~ zʔ$؄|h d)zPX Nnٞ P s9g2`llaz~BHczĂ!ՓTOQCQ=YEdU$C9P=EANlHX ګ<*}($j|p"dƇL@Pz&xB0ӯF$' O٠xk)*$dJo),Ŕ(R-nSxR<`{t@..R<#{(LXc:L+8C$ Y #;'9E>RKo6w z} cV`&b$tOzB]pNzBmR /d|Aa4v-ȗFFȗKH8F4=#_'|оK[p" `N4k8I8@\ ɗ·V|5oc= `'btˎ|2 듮ieǛ䋙P@yȗ{7Ka̹lɗ$QȗF|cjzhe7E#5%rv)NtN%ҤF*Zp"aUUR_ӆP O%x} !"["אz)=}JdtH|wo/v"v}M}zi0|Vӏ/`'&ޕ4s2裃}V 9-e^~ѕՃ[=҆a:ߡ1^pڵ^j1쨗r vP]F~$V^6؛rɱ(.F`KK+H(aMS.!0R?k? [ `as$xt'?#oyG 42*bGg7rZ S-(L]4 Hr f5h3eQ-vd.pZp@$,܉t@Bf4\G\S['T˭χZa7cxF/ SCii`$LRjn6B]aA+Z`~3ą^)29j P6A'B%o;9NU'<<SIP\[q`ʼnc7:>e!|rF%ESƵ\K}^lJ?$l 6o \#Qa?L) igoO FIF&5I)21$y8/2$s0-x$*!gۭ9i* *L]j6 ȍ L}V#y4)EWڴy0ThkˆI3FSrv!7ѓ |eB";d#@n+\M\(lT% ctn86JI=$v{o`>-V `0-`H Ǹ%Ecfs!znc_\78KU/t}U-xo|dVI\\ߨ ;3ȑgai{'㖚lSul4XǦM5~$t׫vO]~gO|{v=ׇC/RQha\*~\WͬFjQ>ꦛ~rTD(;&Rϴ)dl;T s`[}7"WE$L X xnT8i0C< ,TPSᨡU25@ًlnrĮ~KjS$b > Ȃ^^S%˂1mG]^/¿+vJ-Mp΍[T!u]eQ6<İrpU[m A+ bZW rkS/6Bu_@/*`g!7=D{Ԟ4#CR=׆5<{DKUS'xjGnWu3*rVIO:~c.IǏEBhtM0]pꬆL?6r9UY߻e)8Ӆ9ycfʈ>Q%G/BQܸ_r s#6B(:׫PJ\ jeymcɬzn~:b/.(cOn,)[jq HBt/$=+Z*gJnK5 =tX(4::ImJN3@z}2y"]ץa}x , %a*3q~&c{NrvC\$jB=Uj9&ʅ35Yʑp\H8(֥,FZ>%4uE7,# NM5;9 |x M;M,(jZEi}LeCimc_Pz4JtAM-ym[9Zvz;P nP,-#PbI~MZgc ͇gߕ)heه:2G?7Pc]FL Z a+5E3h>?/.k@XFbY}agOq6A|:-؜FNo-EVY.ZE`GaOzꬶa;&!η3o?K`3㧳Ow\w`S{@9 4u^#Zhgύ}teX}-Ȏm?_/]لWkqW;P|zׇlY[pS*7^k>`c ֡$ ^k  'ѭmbu7";5۬=M#Hk5vSp~ lrw,#s"|x&t$s.dmp3A$-]uVz yP%tR H wY_قpf>YiOglAU}tׅ~$4e0Aqk[8k7D4n>·VZeNK_>KK5?ۃ]jgQ?S[.;/pgPx6|R9p^ymXƪY~sa ^xmg85 ٰS{H/D˫CËگzsK@"Ef2ΎȚX]}Jt(2) iƑj%T(5{nT`"oRK|P"TU[$M锯b6-q.^hRVXiwldG)w޼0ʥ*%UǴ;% (E`,MiJ`id Y`v _B3)`J5HHR&9ŹVfxTzwi s*jS5kZ5$h!M^Q'zl?@NOhTRV~&?'zYP9n)?OϚ?7Ns=_'z~M0O>F kt7뙌X!8IXw`ceb@WHHVPrgoS_1ܜg'*}Boz?ȉ/G7ȩxzVT:osa]\ Vy8t{*[.۫~E n[(8P~ ҒD*VFD mtj$|"qMfft,>2[09.?_X@spb~`VMwm79ywjrڳ[=s|ıUO Im,Ql$ \9*.X:+pq6T ـ'/egf aDCp>E\Tه#8*ADDp>tW\ w&y{k]Q>Ye$ǯA|sj`2mB^WM4碭}' |I`u_fӔ;ۮ?wZ2JMs}_s>l y{$S"7& |nL5{5lL3I܎X(wM;>#D/`Þle<1ϪO`&2I tUy#!*2xW@]Ue:Bդ@QU*O@ʡTRK@:fPH:U (M2ꨪ|T"5"/JS;#*)JX o3tKu~Kp7@8*;!L))R5 M.x@hU>t&z/'NE[_3d)*ǑJ9255<)Wҍdb>%)i dhko"ŜK[K2 ki@.e' C$nq1w7mS}j"uf7=okYpBy endstream endobj 373 0 obj <> stream x=[fm?|/A`a`fE$}0`q`迯#.JCR"EǏ~?uço?|??}r{ofo+z#ƹ}Ӗ9}뻯G?껏DT{-ϜgHnŋ!D̷}w_:R9֐Bݹ,}5{_SyhYJݵp|Ix(j<'ǘzɘTح`?'ߐ;sVû7Iyg7mMq7rȟ?ۇן0q &] 99?4،zg`߽F"iF4Žjn&idMq@K)s31%miK1B^J$]­Z0J)=J<A&W ^N.Xq&㫌;g5pHϰkMyT܅<5R *Kt8Lܵ<3TI(zxu((ƛ36Tݝ+{wL˧wֈ5(Sĭ&? 8f؜ 86 F]9XZQ0~Xd~!1Y ֶ8Z2.P-<,EW#1p "(XsnQ|,0"Ϊ_\ H8!B F o9x-@H 3#x94 Hcj'@&vb6pю' Ȍ@|Hp;3% D;4"C@ ({C#4j:0UdFBD23k(V2S,0xD S2&N6!Sۘ h612dJ&oy&ˊ(A2S0DZ@e4yF MFS"}Y#hͿEIj*0y"=7XIQ]`~Ҏ-A?<<)HgI<84IDimQ6 ΰ%(9Q;æ|%wn nM %~@Vg$֖]HCB>MX0 6A9H0WmZ <|/X=+ヨDemO}dRhu坪 缶ՑnYb? (݉v 2COR!r{(+WKnR yZ94+\0E U`NdL,uAx312P+$7F^¨qp&y8 *>A}}VV)fQlP7eu"8Z_n~U깖!piF%C8_c)[!N3 =$d`ܘO.ʹMZ*Y0g-)vL#PwkK5X*A1w53[sV*P0D%BLVQWcY`'wZyEEyn r\gÖG/õ =z2a;$r*poxtI -w:*p­orx~zA7Nf}^tkǨ/vzi>?6l`ߊO伙 Mi@srk-MDüY31:IXD'OH@mfD)#iK0^^@V CC YWd㜟~Q@ksU<ț ġ4sQ!P$Q8! Fl!0x 8ëHg9Me>*e _뽌njR9GE"'J;ʫT%lyiB`>] :Be_[6{q巌򏄽8V<2џ؛jw`U'F-Ϩ!IwARHa퐹I0VyDG6J8t|,l8` {١[8&Ť{J'^?7,opQ`$T|H|ы:UD_ - 5-Hgb Dj"m`hQI*g=kt zH3։=tX\(JxBٙ?q},d ֬O~Ml^[)) iJtCAkNҐ!I[+V~[0.30N;"^fastfG=#g*xTH2[Qr@E5`,g6O Ʃ~UЛ擒Ԥ+UOzV]JxQ5c/?YQJ2(AѰ@DZ/~%G ,Ƥ3(]w" *D^Y,muj`Zb YN-Ҟ1ۦSd’* |HKSN q .eCPnrO~,6| 22CL Vm6]qe͍''lzhi!Mv^2>`AH=&\3)M;]wKRb#]S\`蚤(&=ȜQ(T 3.bq97`(baHQNXTVpĂ2HQΜ809нCÃ^ӱfO1.FARg~ hL~:`4"QEE  P,H3!+k:W C ko6c0*̄ ``qbsVL8#RLƲ\D>?x_s[+V[p=nEo"O5O8@_8yHjm7J-/2[JSԒS/gAӘ:Mm=3jg|gq>E}b6f"<FQ!\ 3dʹߞ|!4jj$ %\  ;0}E+\15/8a. @h$ѐpFs {IvrMet)d8e|,\(^ۚ5ӼxCdзl-[ձrºE9>6ò8>80; hCpn3vzpA-R3^p-_TzSxjPk8tm&FD:dytŠH@:$ u<QHZ1"[2I/PtI.^5-xi9eK)r+r<3sYֈvbCnfVܗ[ }XgŪv5YFvy TI-\ڤU.7:FC$d_Eé&r Scr6Յ 24u.fH]CJe1h w|+Jn/|~^ U_⧻!?{bM5#HΛGOp1t~mO *Me4 =rGʲڳ&<܆:Y/PlgtKE #w(; eUq-BD%H)} qU:b\gJ޸`O\W8Y55Ӳyv<8ZI9], {ÎrABCw%<'K:Fa'Y%L Z v,'yʔDP2avӹƮUTb|+O/F dpU -Q4>*g L h Vl)Bɲ 6@ l^1"|Na'',u`":[8EJ`$\P!ڜK|t;N͇|TpFDFՇtm (Fbym-hO|lveO!|ߧC>"3nϗ,$P5-'+JVlG\w@6VaY?.,7Uaaƣt;qc Ѐ[Ĺ0Gngg3tim,,k `vVFؽ4]qVrZ$5횂s  V=^@{/_^yo@AWv˜fK2߱g6S{zL.uڌ}^\BSzg}Tku,[7O2p^|I8MoH*yay R|N؈-K-ɞX;XO2/V X^ڽC{vAsT0H*uPQiᠸCW "xkz>QƩTr<|e6lUP%6 Ҕk“rF$d*8[I\'R-̠r8qM;jK)R9DY)X@Ӭ\qC!Ǎqun>GIO䠬ˁ pZZ6}gQ04DiDC"LGbn7Ka$DI|$?I cMԩ{r(=fq'o ;(\=C_E\FVMWq7{(4Su8LJ:I  &&{:(Sby (adPAJ+0AJIl|)r* U/^H<Zr)Kjs6 E9aĂN^.9fjH1W˒@0eAm FW +|.aY`+`Ԃ,댎YW\PS^ $1{!Os%hqW5[ӟr;f k/t0_!{OOVD?鐞o&5O< qrmG/s9}V2dEjth)*[KS?";wP_ʹrB֯D<.ywS = nQY3)(=S&v=gƮyИśpOnr,%./}3|dj$QQPyN_F hkZ5!MVO iM\5Iq-MRy{[l*H-ZXyϲej523e[+.d1qҤʮRgA_[5`Td0ܮ߾2|:+*޲ttA;:u0KDK990RqӛG0Rqqm\s|{Ɣ58]mO`X ]V$Yk02ҐϨ-/ni`II[?.u[x4GYhKXuҝ yltaQZ$fS5lў}sݜ>cH͟5@7*s+7vdnNw1dnNʼaQsEi(<#~!U_]-?G3Hx2*ڗ#TUA'k giPib6ҥ1#F8\Zzs+Jypؙehj+??XYy+L!i.e:atK66+kZq^q9'v圜rsOLW,w~x54YIOu`:JѨ=R !G='-%689@ಾBit`5%V#qi5 bO4O }%&W=}5ƯN%|%юuWI/4ϝ$ <_(U]DrI34xx[$x-P̓׌ ^yG)0k ^E=h Xa6]6ɢfa2XVץCkVZrNE|%FUa 9㗲~(M srd] /,Id&u8֩ !c=%~(<SL_}9ff$qIিzW#Ÿ"hx4iFӄ Ǽ#5lEft6FGӛ[@dQJ?i5MTO$[&֚ԩ ]-R QCK#MUۏΟc:J-k\T`Womƥ܁KN* MtW$I\]3QKEЀK-]jƃԌ q RyGB)0!j QQHR Qf#D7қ[!\lF74!jB!sF+ahRi)e \N{O )e?5?M ɦ>敓>s}(kR? k;c'xz@,)igO3̟fT?M4ӽs%ys8ܙ/D]5g=#j޷lOٱ|FTr}Uqo B&[n#bhxmn T6B0Hp;{@"Y9Wv`_R|u񕧖͝+u NUP+3VO"MdWޓۓ▃Ez+9!DBŽ.EȂӮ  fe AO1lsbRC*{nZ;MeMTgTAbmn rs7WTl]'kؘ,Tc[܈?/4 EPBggBٟgF)-ܭUiqئw-ܮE F_R0&f~k[5 RmnAaw`r^ ]M5nWƺٮ06 k՟6xvXd74[)̳ȨFBd7´#ٍs`7=g7d+F|-SuHHv`6>n:Ųޅ{0f۫ܡLuἴxXF$D>B,=[kQ%}R U7Jq#Tg#pm%A&0_=nH>.Hٕ A\z;D;n2'g$.~lSpW/+Q}v .?']3"3_[g2,3Q!j>17bYNeF҉[ne B}#-dSow2AJ$Dr-TP~= endstream endobj 374 0 obj <> stream x= IrC?J˨Bmֲbxf,jvwFVwUGFddTӻwo_~~Ƿ~~ϟ~Ͽ}ytٯˇ/I>>!>Q*6$ORӇ|N勏;f*9^1d;Dÿ|q3r ǘ(O}|E^k Q̄ؤp̐g]`stgؗ2Ʃڄ;%dmH ԉk1rRl~勿 󍜤'ئOh/xǗ/N?]Oo; o0pLȉM2f9O_a 1LG!;$۟ EihLMތ8޸s$mGR!zC<; \0ΘlO7tdQC$3爱3aL'fc #fF)6MhbA8JfsL MLl?ŶD7 [.6Xq^!^cd% s#RkZ~ Nh[9Te}hNfV DsE(mp*6Nz`misK*ؚ(o`  c`8I7#@f<{ku*7M0J&3 DgH0+|C"A".beqȾ(c1.JNu`,3J&*VW@ip=`b|q`Z< ëIEi]\kBw1X<Ȅ'Z K([8#I_yQ{l=]G!,Rik)<V\C +.> +J wct@ E/Z*L}Sυ7![i%`u0-Qy6:|Ck섈<HPNLr~rуy>0&Xq'[EfZ,w?8QtCiᆔ󍮶+͖jʾ*!mYoQF6,,v֔ NO(u0тu"xȺTgRX.-TiSe9yS"ǎ'{R3f5*z?c] c(#!)AD ݤ "eI/-8$<ؕw<+0+rFiPf +If90!QF 08-wn}0?y>PrMtL{9jd $*.LUQnH Tr-լ.<򀊦[[Bg 'u5`Y' ŀMX01JQ xĦx]X4_! He\H-y] XfjLªףCC#nHz? C>[$0#JyDT)V}hJT@NRD%{Hg0g~?Pt jNN?}~NcM >nS%>oB+$G˃mPr,#^$GéYpHlv (&P=wtF\؝\/ 4 kuHCDG&tCLUdӂF|VfrGdHJ~d;8) S4a/3cinK[ 3؍M~`>֨d?2΄{q]p4N<mkS1jJKM"ff)d3ldn%pFg,˸fw{xoCͪ3 i NrddYV/V,~d꥔"u;?13n;w `W7%.3"CϵM|Skқ`!fIxe(HaMSc,̍Q܈~eZ(^Q#]1+^jZA)Z8%.3D&alL҆Hf*`+0cvOYC&31ZisPiE~(7A:V8mm]IFӘg!U&N21Cq#&~iُD'X= ThUuZvmvkG"qyĂ5m*`im ac5Fd0"M˦ى|*pI{fa,'9cvfBo:d"oӗ_O~/:'X|Q4Te?O٫~-_}aDÊY8VxGme$ ڑ< nu!E6ihUq\6|\o S^O6NM%'p6nzWGOQjO%W 1ңm};=D?`C>~獉?ޒw)۪2HP7I"V_W"\]Hb7>>$u1 - ,J 8F,O%4=#Z6:&uWibʪ. Q{&d;4ڤ,A=ek(1M 9'V|5$cT;gpҎ$W$KbP~rFy<@ť*.XN'XXRo~T~c#J0 JpK$OJˠ0d'<%[z9w(ՙS<(L H z( )5>5H(r83@Bt<|H.[i:ɽNj{7MRԍ{|CY&omHhLN9 0]rM}wp+mdg('Cc! 1x@5h'lu_dǷyC~x .r?xQZ.WZ2:R,fG!@.RBu- ;F%XHS{qH¶X&z ڹB Ew&b v(p0`ѷ 3Įg{/bNER>2#yw^,.8)L9"1H_1p7|:&!R ԻtXNH>_[6e)96b,P5E/tMzؘ 3R`ZLPV{Gӓ%_0vFKt\Lwq$w̆?p}3Y.pbᬖq؀aHm8+xf7hά@< -Ѥ%(|fҢj %>sLڿ5Atf8Uia N{ h7ήhAO]z)9`kx [i󬈦1!VN0u[@AͲqh¥^E{PUZY0)VQFNUh&6Hk慫dybLVJ\OcarƇ"5ڏ_?t3 n~Եyr ri`x(1< &ьӡ:g;'ַ 3 @QA%4$d&%I,k . iy) IWRZp=G$@(U@0>1wxCP[y1fmRoކ.L7tfGkq-znaې!1'^6Xf%/s4V^6ݸ搆mZ3@;f;ݪrQw:k2`s Ρ Ns1y+xR qd䷋!NN7;%7ޮ<)%4U_#|s[ 6G?tݦݍ ggk!F ]Ucr*<7P/W(A8gv+!Ffϑo(Z1+U& 3gwxqت%`ES~R F54Bo CF*j"bYL_}oP|A^h7((J"NADL%HK 2󿗼YNRc߄ZdS#~FN\g pV,Flq endstream endobj 375 0 obj <> stream x][7;;ǺK p.Ȱ^a0;!3`JR[ݺOBǭT*t9o~ӧ_?|ӟ}~\_޾tǷoEJseb'v/o߰˟}OL+,f.K3sg9cNv._' NR*V{oq{WYs.񉫛br5fn9~ۮbZ1b*C|`W6EO)qeOoo.?Gi}E9u.jC?޾<| _Kk T0ͯV1/e0ؙqόjOQ=mhs5bA=2.'ɥ:iLhsz2y)9K''Q.3[e]F=zLKLVfsAJEζU (ǸﳒV1h+J!B_~ܙ7vOh I WnhN0PY 4vd?L:~F BL;0%d/GwV)ur0 WWg\Ӫ5$!%U=Rrtxco~%Z~F8N14(fݢͤr9|weZ%$DZyo"'{'dB3] f._~5Wrr !wL7g.?n8CΡwB;MtgdqnC򙋛4\X 07aࢦy~ONgs^h:2` OXnR'xM{FIBM3I]5A;!Zy|E elZno,>Oڇ;g@ǀ>Nbwo8OǰQ) kiUVޗ9u>-glGI1%dns˝Ø 4_o>80 һRsf ]s#LKn0 _ D>Fu<1 nZr#WS1ww<p iD `|D>'z;+EHv^ GvomT8[0Rm;8=ίAZLa0tbU2*r]pkai2 ~np4ǽ`aCV[dm*șA +Ыk+ Nm'pr?[JrRڃǑ{%rӹQ碭Q}MSCq窭u;>A5m"@{ܠ#x/zl{=1| 33,Y-~!>a<Wjb6g-ۭǞb*fpx\3=Gy$/qW vcT&3F0D/:b($[dt;Q y{U*v{[uS|a4=7U,8 pgDbpΊeE^)ؒ,0)APmvBBrf# 7k.~!wk۪YOz48&y!1(4fd""[ hp)K1DfC0*u!42a-DX 5Z:>@1A´1lu k}a?SBf.B>u46i?vvxYfu+t>$3`XV2,p>gj%*% Q{<<|剅m=8 xC|\-X ZYЄ 1ѯz[hs"!"0hR,|1A BU]U$#: (*n;[i+New+5`Ev(IY <|18nއ,Z3ۉM~n w*y瞸 C)g152 \"N(<#yD!ӎGMrq(  uxI7FVw@ X.+͡vi :lsK'MR^uI]ư%$X:)̓|f GƵPmi 2Vr {'l@84H8n>c 0,eϘ!@(-PJ׆#ʣ:s,,"TOO*N Ry1"*S  3(lG$PW'l  Uļ)*lwzhjo  Z!}obV>"3+ai[Ms\7@$!Җ 'Mq XDCD36+߃&[$m+۲]`MڄƖ4szfZp/pru6 RP52^|L$$"nw;Xv|Ǜ'%}Pѱ-C8f3e9;kQZomXVtsWAij̶+agxu !k!a\uDM6fzF5a(c-6 q!o#Kc35`=+zSF$h~ AKW=@$;/;h#|sE_81Cٹƀ&Oe5^v2py}y%ep6Ul7o7iCPoA6 +6ZD3[Dc\~bH* 嘹IلZ!6(@f.+obs1p*ZytU /R5ǝU,UVa{CWJpk.'C\T+}F%*^ig#z?@&RVU5.Bqr {G'@3x5MfgpG>= *a ~@v<񱱸1.?vFLK8зqAN >S %AW G>1R/DZK^Zwzhjo  Z!}"Gnq1常IRbk323{Q8e9Īp郞ߥ6xc*t t(:$OؘXѾegT+_rDg{пǥ&ooa#l>acZ?.r5۰ !{|I?.鴩۰y R"a6~@6v<Քfe0a3|RS 6Wh 6l0Hu bP5ry6WD3h =H߀51 e؜Hk߷(-GF ڿڀ[m@76VH;9v#Y67)[>{-2佘d@fUz*A惺*lLGcۣȬj *A惺2SdaMWȜ~Wsp= (! d @fU0)S\ȂX<և47d*L"a<ǵ'd}ݒO׹bTxYha#>cD W>]gqAÛ\)7@T|4e~:~] =S/kOXi 2.ڎRy*m]pjxX[JNq1pv܆XT8kԍ9tEt.ꙧRrPrw4GS9p4$fԜPg8;FmTxjOOuղf̓Tl#x|˩mTXPYG8FkنbhPǽ&Am{C9Vhˡ A}IPu!&6h.47ꂨACqh܉ˡ 9QNs!(6h 3"ʩi" gl&>F8K:r_?n F0c5B6oQW)HGeXbXq+Fh C[ImWR>z.Ov"eY'W~~,e`h4W&H&Z*p57+w`re< ϓӓ! ),l挄`{4vçTg'ĿsqW\! ^Kers6I ݦsilQLlNq;cBƄo=ĸy~̯Zԁt#GO؟ĔS?z۸E6̔OéaJl֎=<,S -0gk% QIp}Y\лQk#,KXM_ЁX)CSn͵掠Sϛ\ c O?Husb 1If$`W`5LiuI ^tT4GFHcmQɜ/ > /3`*7~rY`nˋ&&&/6wϏMϏ}9;b@'ʌG4ڙj6dooO'0f$M: mqE^="}3 f],31$>1˺1 ,iޢPc^!/3arJzF>gn%6n!" 3ؘƲ\J8}ِe4eprqu.Y_0})Vɓa]||D=mXXg-n¸/gEh9ebnKa] wePvꝫ()k!ٷeC> stream x\[$7n~`CY5 kd<`8ㇵ7A}HJJ}m`iHDQi/?}˧ݧ/o?~ۯ?ߦ~i};1nB聙ql߱ǿ j |wg$ Lf2fܝ~˟߿{ oIJq}Gqcz0r̙9kbQ1 d.SZ׊ Ul ӌٛrjf%wۯxJ fI+wc $?o߿=r}:qׯì1GM`G!ƌyVyznJj5H&oFVԣvY;p`2 VYa3g}9/hL a2U#/q|78pQ\Ck+qI䵸Y\}}Kۗ0ص\\k\5}; ("g'^sY)109QHI24Ka$atgvfgraZ7[&Qvg1b<H$/dnGJ-?_'H:K)&fL10}>IzbwP̏q3)GfQhd20pY X0g*ŬXgЮR" EG`1?Ma G B=A!HƝ)L! āuF@adj7X\G0%و1( WOU f\^QeYvYRi'LySpa6Of?~咖0a̹y i9,q2TZ F>$[2Aǥ E'H p6?MC@"ƼdP[ K^}pV|Yf>e{oປԄE5WWr&b d"" fTIRqy{HL>C{BHH闠Ʃ4WD&,r;: }a23=oŢߢQ#4V'C`{)ɮ$m#r Nh%d}#q`0s!qNÎnNXH6pSOibebs6@܂:L,d5 >KnekFaXSk\S)ށ2L} a[=cJ#Һ0&&ӣh6;`Fo4#z"‹lOt|LA*ZLд]{cH~c-bCD~ x"x]!| c.}5B\QWa<?z۝A 2~X|2~/"Цܮ2ߊ-"ٍ܄. xIR_IЂp6<b@'QIf60paPLױ %t5HվuOVNp _u؊{sRie(뽮P~mVC%P{P |Mk)ÿ5cs!`BĜ,n(H5C&1Ra$YrۀZhTQ,؆IQ6nPp`,&|iϵ4S/ Noc}dDJ吲qqPUUe eTNU ƺF_֚PJ35ٮԄ+`gaQ#0جlȥx8:7(\W )'L]XIٲ0*tՇijfNFaɶm*ۉ-6 QDn7TE69%]\cq@֗vp27a6&<="] c,]ohޕŨjPՂ!d"R1%, cÚPv:㋋'8%hʒVMQ'Y;hQ0b)84A \oBW ®؃~K.<ЁҐ{BgjxJ_YDWct b#,L'_߲|dzśt3r>HJLW%ϙ&⡥c(yn= ],G\ GKAd, WN{@J&{(sC RЮBC}R:U!b^oV \Y+rG?PgHK+j3aT8p[bo hU`XA oj' g;o@=`31 v퓣[e} gyg];-Jw6[{J]Ⱥ\q!Mrӓ]ռݛz@)(DN9r g$ӫH") MFAr%G\3\'l8rQO2U6!Q9M7f[ZR^jʋ۾U) ?NKb6ΤoR~[ָ۾Q-.z1Lz`~rZp8{baN%b!A$spBUEluL`8e>n碗;v`1gWnf@ jWu_}o?n#}0uF-XsUx5o}4^/)SSsjM_4U ]'~eSw.XPiw6t$7x^=UNTK&0g}Y$1 a٨fϑ3W.u pEv^̋hMFwgU2e ab%~?{]UBOjƗXDU5O&9FyRx 9˔c+4OK8LCaoʤ^sYq1RL\MKI;!Xj,Ru=HGQ FNOvS]HA EcU \Ck Bf혪 *a'NYPOSZ&CWR|i"$6ƩMK 5N?, dRr}) 2 W4.ۂϾfC h)􄼙=0'Z.jOZ k/!6CIĬ*RkGV@&bxb#B4B"PNig5G??*;Ƞ>#Vxhg5v~EVۨײN;ҭ+6R鰭 N}qu8$lFGJ 3Et{> stream x]7n7a_ ؇XoFݝݢE.C&i. KΌ4Fv=α!)>~~o?/~~e.߾x;}813'$_߾a~OL$(6Y^ &.BaN^-c]ٙoroP*gԓP;޼}UZO&<>1~oNnSj'cIZ9J޾ONJ/}_[> sTALFMcx/jF1gV\.ԜR}0m; ܤ'ǺNmHpb6'05仒!DBʉ$hl)#R_`A7[ɻr7ۈjɨ׼^dI|O}|4#%,@-8?ن$v#CnsG(V?7P˂Xh7JʈGp])=ϵL (CQ LBfL43u-(SI8K(M5hLtJ@.ɃHL`"J0016 Y w4,MLZLIZ4~8fNB Ws$s\]%qB!Ǎ\8O⎫sɻ^m m"k@EUv2/ fݣt=eFWZ v;S .ꆁbRlz*U̫L*W|"KXGCzP۬XތJfT#oJN V^S?p,{|J\g𶀬&_<0Bӂg^<-ıhJN06g&:j7_0pl*lyUIG ޒm<d8f{6K Śp7X+Eǚ4vYYE4&'>Ԑ#p@0Wqʢ+xTu<&,*#rϡ =^aa`@A[ěEGi<֎iQK`97UlDMl)R8Ŗm mm8SDR=(=عPL[W  z?/{[l^!!̓!ݥ!FR-jN}y!;ez}sU ) Q*xAegxiȣОSFMG%2`9WK)é YW hp)~] Y;uKn Y?e5AQ<-3m.j-n]?6hxAeqGp8:^Π7& ]#Cb7{gR eUpFS{'7L=ZLx[4~8fEgkfa>^i6Ss tJm&ڧ0)5|"rin\WuHt+2PαhX8l{wCj@qCjW-D |=oc:ruB \ǰ9b1mmܩy&KNd҇n yuB.Gk 똎3е1?qF3)V4UCZ.B[lT#Zx+,Vv̜5SLwJ#kxKȰ6aC.ˌߧdjXYs&MhجWP̀_ Vrgrp?RPJ` pњYph_<-tfv3hOȨ34Uвeac!c"`Ls1Dc<J2]7͖LSBon VP8cfu)#sz4(|]R읅_,0=;P Ȅ4$iZ?J7?I%̼iUJ~bй8}C8 YnE;CKݳMQЗD/U? M_:B)%:Cb`Y]K`nb9&`S!X9Y2H:0rIES4Z<+0Ji|W \qMMDžHqaى$wɅY.b4N%ǩd0HIJ.5Z30 KX gܬ]׿Adqǔٲ' F=mv54MWx }Fh̴u~F"S8qv@un^g*Cp(e#pY  B L"ZvmZDX m_]PzŊ7;HYZto;M`)Wю6&ʎ*Ė-;IƮE,'BLHGpuG`܈yVxY8t#D U{8(?#++ &Z[p'.!fYw!$.PHXbNHWprR>둬=GDbHv|Ah@t98VK6VnLg9T[uBM4 OP R E7Q ;@Np^k BaS<0jr!:fʉ)xNvVS>\L44 ~ʛ0;GoDtŭH,Hت@0uApUg4ܚQ L].sh QTg+>mJ&ZQIlQ KDLLFfǤWHx56 6 i 17 ֏(}DDe¶!m! MJ 5;vn7va׻fz{ʋ<"Ko|R;|XJ#5-LϦGj ^Osi g#5t -NԴuhDj5jy3>C+E UU#tlfUP AG-v1[7&H}l_W|h(@!@c[iq32|d&Ԥ:fAݾ.ۦ_і̂ yfìt>n9iݭ<`AvB鬹v_?sp~k/y t؎:I\2G7S_3X6%ʽ ,0iW)a)wW#C.W&gT1N_{XyZl!DWgY-W*C!J!E8tmcd9cLIs!mptcvNMD1Vy.a$vt279Ϟw6 e-ՒߤS#G2kGE܍.uocC/t5)B4m =ۆQa@9Y:JBR=fB4Dd_gf^6ڶZ̶~3ޞhn1O>DP!>*ѪǶHף)R!Y۫admFnVٕNN Jۻ$k6C.ǯ4+Wy8JAQ+"6'b̻Xb93Hm52%eU' Om,BAn4#(Хo@jm7EY(.a.^Y N6AA5S*Uh:wA&.  FѻA.CQXQ0g4ږG=9;߾>Y^ʕ/7+ElZvgUn*V8|B0t,Rw/EK.wM\yYZ"(X7 endstream endobj 378 0 obj <> stream x[ܶ ;.=< {z-Р.ދF_'E&0Pۗ\I [Y~.׆rxmtolB,,uc=]|Fe2aC~m$[ Icox4e Dy&Qa3k;kŵ@h.mTf~3I,y$2.nBŏfμv1y_aDWwlo*f.I3˔ 1tOt[B4˺ìMxS/L+5-))^J~(wU q#br"19:jGi 6䙦d#@ȳ.xa4@fCPB/HB!Krb3NϺPBW^+sg&Q֓kC%i2oPv[!hDa*E-MЖQysʤzu|޿eJ]F^;K.@[?EX.P\. ЭkvɆ$AEniՆ$/A_HvRAEA ٩L-.;#nϊQE<;) +:Xlw~rN w)c9'Mewu90!"@Jkg1d\rA.:(v", Eɥ\T[m(|~!E)^mҳ,rcq%,WsgvpɪÑ63& 2!epg(åSb\JX)mg\'% $%ض#[&ZT̻dM2zQ̱W$ UA(d+hCQxm*Sx Aᩥd~!EiVme#hXۍq{uAip@)C|Pv[!;-+$՝V-ZЖq5~|eBt״M DcJ/9^r)RzkG!J/J/PtXscJ/ Jo!(= Ir"x(w*܅ l`tWN<1p2) /fqc0˥3d^3 2μ6AϴHAPuK=OC)Ƽx9"I @yl(Θx~-1y y䝱% )θ!h j4n.]wfy8о%gaCwWKI;+Z-k3yw([ t22'pkG.3%]H:k…u6OΩq rƭFb:ۯnؖE1g\pԯR'I {<xN!RL玼aKOsXtIwe 66suHL ߑ:ْqkpo57d/97#xo봨 $]vm)E(Ucט 0% )BϕFQ*5;#2$$\7"G (:Rp eCzn`/P9k 5(W  As_27 ~~ JR+͢d*CAXN宏V\0pPiqpUEY E=$lIM"$ Csϝ$LHZ$6Vh(pIAHI\!$\{ք ".P~nQM`phBQm+IPfQCx "^g`Q"VEuDIET`6w"]hCQUpd)'hCўƉI"v*(AD<䶤#`AJ JNUs6L66$m(Ն W6eG ey~o%Ra„?Ϯ;J6C%MYyYI8r釢 eU瑥 e{o'a?N)<%9ض# @{ŀ~ F _to9D&XFuKxӃ 'Z*x%7Zʣx( \5cxUG _*iNQK?Z,ړx8|_Dcm</Y V NptמC_2_!i?U}H?<46SeGTyoSR6Vڝ :^Q`K&iFaK?ݧ,ݧSx8\!_Dcm =g>j1 _r/B]z} ICt_4@tfC},Wt.bNtttt ,5{=j(u_*0;FY.Pt@Ttim:ExLl[ =_fnUo ^&Ww9XeK6$g XefD , JC)Fh!+[V\H cM*NaKOn,ᄲnȃqYAH\ $Xm[%" G1**&7+BŵR.IFRnZW\bp7djC,Wd-#͢LT2y<ސiqEڪp$K9Cx8ۼ>JL<G,X[B"  ӄ@&7&LM]p9Xf&L6zDU<  7&,!WSx4 3@?;^7%%}GUG Y؄J$U ŝ,~P$K5 ='_)` 7 +Bµ`m0Pu XT6\mP$^IцfQғόEYPPЄB:/23T܋iDU H y:~U= ԗ~BQ$X( ޞX'ةXz5Wb<ܤj\ťsh#ʖΪsPLP6$a`T(P\m(BQ$JP1eYJ  ǖʢ*j,s"=ɰUݟЛWMҹ.mrnG^EbŇyRx%f+fAk=wUgٚ"Ő~b#KR>1MIq9:y$Men:*-%w'l&?uᾦ"fSkx=s=>-mqx { F|;Gzn endstream endobj 379 0 obj <> stream x][$}oPƮ@]o 0a^?ceJ) YxzB:_?ׯ_nOu˷/׿_?\/b/?z\]hK]rǯD'T'{Ϝ;WOJ${'aAn˷ͅ XNu '7?QѦ,jSJMoT<5OIn3~$7W.E*}r%Vb.ʫ`#ؕ˿yR^EuF\\u0>~>._&嗟a2f.uϜnTM76Y*Hw>>y!# ;MF=њ"OE_j>@p75gW.*H00ɯFbGV~Z^4xLC25Wʶ" : ָnȣonAo4iW~TŠ̍A3.5.b[ɺ;rPWZwQu!x&^1L+D<}N]RӞI+ s }uCx ړ{*OJS sC6 QevN&WФOONnxoI_(͘ KESIR ړKߨФ2%ۺRؤ*w^ ,t{78 >S=; (<WQWM"_Bt1Wj|'ߙ~ʘ5s|U&hO-<6Wmك5MEhknX[=~H訹tEW=GբFm2:] F(0+@!*&UԠU(qh֏Fj^ W&4h ˍQƽ|W#}x+ y=L^43/u}~;O_x~oyW4chxWhy yB t+ԉ4J7 nh `Y+j?@-cvljj{BDW=1_}7̽OE':g\NN'z6kL3rְPˑyOpUWI:xK o$IЖHP'!=^ӭ3Ʒf;Ƹ) &B|J>+9P&w5Dkl d S:bҡT˧ըJ NMRR&VS?9}{#Bލ~Oqb5҂|*ǚ~|j{ç]!̰Sec! <2ʧz7'h9Dͧę} _'I5Sdͧ`Q4\隦L{$Ҕe~ 5dg)τZx( hm)2f|dEVb ʞ QGtTzj?Š H}!X4rot7!Pt`x=ZQ0mT #RJRfK)TJ &Z|Ld&)ejך R f&)2J}R%#Fk-VSh#P rjr:#}B*6/Ԟi0n~oIQ(Q 5 MJtO 87& eR+xk? -v.ސV(=aAcT]י BYWLV[F\\Yt(퉢K SrLrr|LUr2#W&Dfڃ@fGi +37(6Z=a1r%}L7bòBQ(9sIީR]S[ZViYs 3!XnCĦ{e#6xl`(Fu : 8/!,ZA;4(3mVi2ͽXT/vLSǟ7>H~6*ZD;VxCu= X}ˀF;(lZ50*mnz~AHq*{`,cJ 0իA`^61l^&5ڹz57( V4Px]PK-+^W(/MwnߗNA;@Mȷ7ܛݕ|U9k󫕳.S[}h香(g[bvv#Zl vqb!K[y^)D/V~Y (ghXzSw{u?qDž>]qdЁFƱ*dbswtOCa{s41E;=#Cc٩K2#A1#:H#+<Y432Gddnje'3F`K^sl0PH5lI^iYbdҍdsE4hԈAS e]uleXYѲ0\9_ڗosݞ&[{[kH.#Wn@n45hS0̴4)i!mgOM@?_hb81OS3 4,hG-<xL38gL*du~y9t5/JO0)henYB[{W5'+X=[D d]eL>fqW} 5ҳ>vl1nBעG |-:&&Z=Zk%OZj=BL&8p" 55|ljA֢ц6E-fj\=Onj|dibMMpk;PfJ%KˆJ`bʯr1ݯI[RsP͠VVmxXlh aqG$T{צgi ݼmG^c]꺮*0^Z ӟs?JIZ|&X, &|& >`|&X||&yLr "=M ҳ\zl d%=`HIIjAIej+S Znj6aQ*zOת}#DRN`s'_">b i-xV[*vV[ٶ(nqcTCU*cŹe>-9e[As zՕmsΪ+;(!qGNz M7diI%;+LSǟ4kUW6+ꊑH<,Fd!?vɈz1.ѽ-i{C݆HSًM$F%`=/0F:6e)T,,$F4ВcnXK}Dx99ziv4}o7)Ė8~6/F_FzCb/NOuCc+ ~DzP/Cܤd˲+ក%O/K,"8 l͎ X[\ & J^6<^jnxXiA7wWrp[ ;Jg} g?^L D0^&_c )p(2xxKcÝF)~}f~OhwW~6G[`QG\{!"wp@FL +*EJ{,ʦZH H ȔLV^M.vg.ݼ40,8L( fq3+r^b,l\p0h  O0S6Zp9)C& us*\}I4 |󇪒{9'1L= ?~uHѤݫ5ïF;%oҟi'<6W_9w{[k$IS9@ܴW u1W4Q@mtl0} 'Y-=Qb6^ZE';{~˚_i5se3!i(-2^ӻF(NX8iɅX0-9j *`Ir@xb=M/"<@`N…9 s 90ӆV9˃vC*mŮș +~PU}XO+d嶺M º?OBc,Zp3p g g"?+򳅧ЕĹULl3P?1_dpc$s鞱#M󃞘4Q4f"0JҤn1({ܞ98:F#l~г$͚WsnXZC & iд%֍MxsS[ j(UEtu hrҗ7jH9is*̇wւef!M &@!.ׄXMw gKGjgQHTjKpo췅Dnm{4)ŷ.ѽoj“0J9KORN 閔#IG0(~ i90ӆ@BnO4ܑrၦ{RcOw8Sza|\S8q`ӆT)<O1h7d'i:ƒן;oU+;bd7]Nr*;jYY͕ѕā~&ZƀEF/6p(\9H6 V86E؋ŽF&H-~d!L[S>5%̈́>xoG{{EE_0߰0 ixDs0b;?&<ϑ9*ٺ\XLА?R2-|CܑcM/sh+&vIH|I{S)CX}hT\vÝ/AGF[V͘(JS{L]\fV1ݕ׵@7O8_O~)/N;˓_ɷ8Dlgq/p/[~ݿrʡv ?7V{|[GAvzcq_ؓC_\f8 W)QP3dϴnNǀN@^(*G[x׷{v>Hy|^nz)-Sx'rz/ timWCQ7(w_C lR6{ޛVGO ಒh]lM5*f'Q0@ZIS\ 0LRKEQ%+Iԑ?=<;[T90 ~1㮣Lզղj,{)L^&y?_SxQAϹ"FBG,˷ȕvCYa[t|J餅ٹߑ/ ;u&I!<{[>Zrڴl!?tZgN0{|` _P]vhr+']C#xq։M'Go֐֞(1T%.:Z,b R5'wT!=un LZ]eI H֞۴;3~, N8N ;U| PPv*Z_mY'1ϑ%5'J,-<_@|VSbOB5~ Ur0FLM/1Z> stream x]ۏ.m?G;~Shuч Fys}G34qa`zCRE'JO/O?=O?}_O_O|>} w?Hi6fֳMw=~)kOfu]2*͓3-)zsY^wQ8шSlR~~/G2f-W/yi{jb_v}SŴt1bB|6 cޔx8%6&h<7I z-V:CR;*j B2b͉3qEQ@J#ǡ6ݨٖ$c{|ڍ>)rq/rIg߳SƅXҏԓ<  >-h}KrȄm($ǐ%Q0 dMt(rtA\%7Js .6={9lUTg(6&S4nV&KNx$߄I  l-/[0~=ao^~=9Lu0wC<1Gkbt3f}&_F&q"&]svWاԎ% 2;)C ]e8???~u3iVUҴKu}*`;_rOoj; lOmoiܼÍ :L71b5VN^,AR_wri5nQ8i-y]5t-$Vs.@q4iI32!&fd'MGDÉeijΌ;H8SYM-&I$:bMԤE.$]2)=$E+Vepw錸Owꌘ2Ӟefit؇HDEZM ɩJ{ipOuuUN1~:Aku'?裔PI#9Uz~>Y9a 3ӔIee u -$<'$Q;R^dzɂHv8 u' <dTOt X;;'>%,G@c(6+9Kq'y=wϓd>WMqn2)N.)q,EIcgR׵iS\<ŁyNq4ktX@#p l_4ViK4MsiT#^Y^ FDݺJWynSEc (R]IbhMMgNx%MJ#H{'J,(>i^!W52h_Et0v3I*&*\(3M{pXLݪ".>yRd;R`1M_a$%S`o=)?Jފ_"nPB"Oa sK/hG,,web>iSrHNGNR̖ma_?ecz3'9Ɖ75lh[.ݤ$DHVbl =za~5܈ r~ #H3qBz <;ʹ}24ZIyD](e {l봻[cnBeg|c~aTtD e6 l_%81{fQ _nJu?jC.-0.tʴ@leׇt}$:W#YQ G @t#d؜xA$fop~XZ{ s%0m9 jh Yɢ ; o{GRh284IuB}O$xP&$9QzVQ}~j+uRnrWӘ%iEJs+ uVt0YfO6a񣚡/814!sNMLMHO-ໝ$& Ł5Q#*_rӦ;rHuXmGq N-N8քxa HNpL%>mӋgL8jH2›6w iV`Nua:dmX,-p>rŔwI2r<2x"{/'b9۫ u3n?&icݤv!6cCԉ>;^r]V\}B iS.t@hatvON0duI22 eJa uV9Tbu? OtX(c$EIyIriG5%΂*1_0󻊨Vi.S> /3N,&PqLՅ(tN ⌫J( EM.i4B`!fEZhcusCܘq.j@PH %SrN{_ EV]TAX!cSX%QO:Zҡ{9]Qj,X~C׋kYca;xRX\l3yqnɶbb"Y\u )^ΛzaOd޼u u\@;0_MjVIGb&b x AA1ĆAh@FifDû m(ƃ yXQ HH78J=:KBwnIxb3- 7y|2@vo .;4MU}U'<-_V9꾲Z[쇍N @]72!!&FL;e>\?)&+\5p ̧'ɘDuD~d B*VM0 |C0*;n%Vr{tÐ6vN 8\5M4I-C&W4j4U7/\i(fc_"lPچ v[鶟Ek S\rb),q>B\TAk7R# y-ݧ*aP'-N!%iGsh^^@SC寡woTTgk5s5+bQ'4'c@F;sviMg+-/.k]qtB"<.`<(^kC6/ hV92תњ5ʋB@HA{ Sl"/`B{] ҚS$C)܂OX^`0'VsәP4FPXQ>t+f5݊\3Lg#>E/.'bI`; OU+wQط8_S*^Ş7>)?-jV{ ׀$%%X󻮬 ϟw%oL1)K_ԮղSn˒/Ïs }4 ĢPb 2ڕus(uC GVH(PLC f `HH5RоZ}&̋ǘibHހdyY׈-:<䦿`#_$|\>tP^4{ΡpM @]C71 !!#1=[jeu YEq ˺Bsŷ`IMgE`3T`j<.;v%EJkPN re VPD% 3^h2 4ןMWT%r!D0?KjIZkt?GыKt?bIXs(*L*-Lm5X p?Gh}^Ԭl35#϶?ӒI.֟]w˱Y}15j}|Zu<]zMʑk>֡sSޟM :ļh VRv`rΩ^Kr-Ze"-<"s8LŐ E 4H_M<)Aqi~`} =@}0ȟt!ٵy^W5Ν%cxMn,fkH8q$&G/ϐtAtlf%hR1v-/); %(A@G59Sˣ3{H y8O_ $\Csঋz$@OpiY N<6( `\D T'^1SQz疗cy5 ,MV#]٧JCSlj@\>ݮE>LU!H4N~(%)3hLl"0I /TK4pw. (, I `Tْ@EDt0;SRXr=@7_Y\B]T]h5Xs^8~y0Z5 ?MK&txR+,Gk+;<~!̵i K>(g> -d E쯎Wxz=Gsہo9}{Zeՠ'$" @=$4' i οdzFHe2jl4c̴d0h7wYgObpz2y{wx @WL~HHZ= }>5e(F K 6! zV-_]ShV)p:@ O +E~Q Z9_,C@KiW3 1 gB{Ɖ`pXXYٷ&βtL[QQQ}Dz&xM`\u8Wa(=k>1^V~vXR FUYJh$Fb|rlw%߃smjl3{F>YEat4=c,%x t#n)pG?$Mok u-]=R7 ||6)9?i٧gZu7L}+l48 D: 3[t@F|u"|Ҟjwm@߹]=z7ozOy/UQJ9IQBD+/#le>=I 7]R!Xk$N!7Rzo^k  ?Į N+i]&ZMhuErz²0@fa/%A1O(Y1&"אҁNыKH@-z`gEUZj,)-!W Y̳SZ2 kzڕE=l[/_z*;W~s*g4@aM 3zhE` 2څmr!.0>Oy8jlde"ȻVH @'XL䐐 l+6 yt}@BYV*،'AI1yX6#|PP lWB)$>딠 (}H 0w:QmD +phLW) EM.iFm0e6)ll '|yؔw.Mh.=feǕ~f=)&`+æ8aV `Ŭ Yv%EJ=N e Vfʊ;zAQ.(g%'D<4QlxEvwBW#|jYO&A}2}0*Gx^\STZ,Z5{@5i1kRSP:>ok}VJxuXݓfJK&ލvJ;PdAݾwf߱IV;seM khxAV$<-hu :g^TTJقz @zd0 CBقz-~ ząV2~sxxY ޟz5[}^Uw7v_pH=iY3jJˊFw5t:nt\ iiv^Nq ;c|oD sha()hGɋ`P >+xnWVVł ShFǍT {?5J'VhP4f^4FTTWj.@LNQ YHڇ6KSDKSDŒH/)@=.BVWDRCeCX/+B}NTϘ+D&ML%!*d L=ߔ|aW2XoFw]mD}nK(Z#AV5{Okj/T$ʌ. eٰ`3tK'9=)m)% ;`|E&,M xKĽ> stream x][-~?p~dݥX{$`I2y0̿VJ-T%ucB|ݵUR髋_?|ݗ?_~_?}/IEkw/I%?;aCiC=̛ZWRX _]}SH1m)oԷv߈o72%|y`s7*Is7b4'ÊꇊYnՊ&'Dx ?}_4xԋs[^$ϟ~o^|?o jUXy$Zg=7^.۷x$Zno'oάuSjŇq<܋C$ &?ơ ğksS{SU&&Je݆PmY_Io[N OTx8ֺ +4oF:{/&;ڀRlulL_]D WC*F g~]GYgYHZ5%o@n6B.[Cin ژKR o q[Q?{!\P&uO$Y]:5cTDz:~D~u5*4o/13A/|aKp|jq7%k*|b1]B~u~SI/M1S}eioo$=<&X ,g}3?ڗ/ތrЍ7;.w|@毾"}++ exB?kn_hVlifQ ^jpQv ٹD~u9(UdWWigmSB\ x@eeGi8A$h\]Ȓz\NBb5]hIv’#/Sr0Vx frd3>նyh 0 C`XY"8޺$2݈Zkt+> 5=WSDMQ&pyaWEH6:jʟŦH)t+&R4 1 iKW%M)lZXˆuJ?RPo=ag]Ko6)#Gc(ە2r%2 rܐ(V&7 fDL>|ztl(H> =?17ڃĈBtL٩f84IzӒ vEl:/b3A/Uq[+gMޭ1w]0}oʑY LDu*6&e"L.I\YZ*Zʇju(ab{.ZYΛ`f$ so4=R;#8GimQ\7Y{ jUs&j^\:ڰ.i4*LA$7Tc3ϸ֬u7Am%Y-(eUNkG]||],?'RkTJҷ yt+`lfL@@{'@4.`z/~j8+Z8S/"!*j&w.s?Gw3 3/S&t|nk+IL;=Z\J挆[VpY`Ŀᔱ-uiʸ;/<)#F\drB[NeT@G`eQ/mF20EʆDR,(6QgBx #IAUm<$tz%=WpvITH-RCPV,. 4IU0] Nb yJ %kFb"-QrS6lf-XcEQ-'fT57w.ShqwmQ>f2_" hN|1!K+ynB:IG3LGs#{aVЂiw֛Һz8c2iM]`ZOLr"-`0(]BvzO_A)5uUr͟ 3E't ])FݼdN1 @|8˲eeQ$bpnB@M\ &96褞A^,qCޕghț :x]2yk"g IQ_ ot'UA`,5$[?8sBi&,j ـ3^4 ckRQݫ֯zWZ,ƍYW~B/َ^V _߅~C{< ´A3#.B6OmS~NHǘ7M9c__߅oH;Մrp`"`4]B~Ҟ۟S;}oUH}C5\hkdWԳ7@A@v8lES4 كl 0$v ˲*0 ,˪;+xuCDw/:K4Iۃ,w]kl&`Df$ s˽ŲptC?*b ִGpё#90 ÄҶ h<5fT˻Vj"2U\;L* \]2\D`h4ZB茭]ۼ9LRf;[e&eު|oZJy^Wql#h`3;Nye6u=؎ݑp(+cs.F:8^Y֥ &ƺE̲6MTt=? 2s]_1]ڮy7}uj?BҤL%]%{ɇ)!%F"-e%fF62%6EAhp+&65KHvJ뉂/sl|z) \Ȱ˲*࣭rmi= һd(K=hfzDU> `W;q SSO0N5jNTnfqk'pY]0p*Ll)pmuhCvaÐJAs l_&P>k=Ҋcj`MKf]_x  2b4cPs^fiֺu}[ۛ%c|Z>S 2K ^&t2K,0z 0cdB:Dw/K=h2Kxd[uiL_vQ&k"ߡsrMIy{R %3oз< 7狀U%/m*n;b}[<*uF'oˇϼP- @9iOM 1 'I^K k]B\B0Q>`0.!?4yn_<1{|;_ >UyI.M*vLҌFK113НʝÃ'nA;vK.)M fNnݻfD1m1l|m 2nYg쵛mh@L3jf + sUhN?w&͠ݫ&kR ;U4:8̡9ԓ1t qB|>r嫽*S(L] 2j~r-]_sq trWvӿ!2_~UnWV ھ/9;틳| io"L(>HЈƞW3%tP{RGҝ'\Cu n>e;kĶL8]WqqP U[Ώ.!??=̶נ1ޝM '\ E+4˰{aC,N 8jOK63&hEj>mR'JDТ+Mfe$ 9L$n>cTkkQY,\Zu""S IU)PXf3vt lq&ʵwy4͗ z(&{6 E)k&F'M ztklq:0)fԎ8}1%'̓/Y5\%.QV~pk6FA3>׷Ώ,Zշ|_j>jw+bXD+MW_||ų8e*`̀t2|oD4DMK@UWW UffX/Vy})/Vح`p5[+zFC&_:L8};'yW#X_ThjTM`Mp։*QB2IP;/8f̍Fy غh]TvBF&P=/|fp~K]W&h4N1H1l|4K Lò* ;Y x! %A@I*& T^\&+%qTAնHtk endstream endobj 382 0 obj <> stream x][}0Rx}  jF C_杜A[VWW"׿>}x>}/?>>]n7_ɞz"Ĺڈ>iK6N_ 9oo|yJrc7q puDq+m?훻3c9!ejw(/u. 6m28 bMMQs1C/=uLr);vJ\bl*BIZ v2m~<)7vF=M"7zt_Q̹NnZ1}F[hgVN?\v"4-s=E͘\ݤMZlQϽ_2%NDlbjҀ ,bӂQ6a*$FpUw4oFg SۦiI1sV$gP䄨fNFX:;˜:d=4\P z9g. ZOx>2#7%K vU;Dܨ` Mi zcSrmn6&i6/?|NR~5J_ch?kVi*{U'*u'O=%>NzU3 ]"<Ѥ"9w3 E .*ZhPK)xoSCىpnn*'#nԹ3f J4B9hZ8iGJ L#%-'D|@<%xДd(]uYS9 1^oÂ{(x倄WaI7`*å˘ TS$9R@f6RqzQj2#%,@c܍Bs) |^R=51^p@)䉚W -Y[y_ q&n1wgLh3ZC=jMÈY{*kp8XRw%]  m9?áܸCF0]fk \1JK}O~ Ÿ#r=o_o7@gĐ7H ,NK^$(H:>#-a LX׼r9O]ԴұoOG:~4"PUP!RÉvFpdS2ueIHoPj@ *m!b޲ ѥ366:2h|=)` 9!D``&S3̞ 9!TnXF@uFU CNNdg a.4})#}aF(n2T#bPP }0K˜&4BU4k z .xV7A:S*F)8ɉCsz ΒCO#Y6d=;'IbTi%ygz5+{Gᡡ  ]jW)U_ þȹPI4!F_ 46܏-C!γij*wV:PE2#<<%4"c#Cb(c፝bb v |̏*XnO 'O(%TdbAISS1RpXc"En agJ-[+g P*,rDwȫkFULSD,1֯#S,c.K+IUO ľ~apOӠFH]2+5B (k!AN=|oiP[C#'-Ϗ>H}̏Wƪ%9f,Yr5tz#Ҝi΂+R*uPznjr,@bթŅ[vPysG-Bo<"y*d>h7$a\BĊ-G;!I2 Ϯxn{IkPRo`.{"(XXFjaAOv2qNAr衵PNU ?Te*T9K' xAUn]Z8j@Y?rFYHq27 6HvH5'ݻdLjU>$:ЌĐoEyE%;w4.( ȧzYT0-Mqo7M>4z .5b.&na2H+#5~= dgPJ@2ᡪaYranmxN6i @&vI&~D!aiR"pF ÄE=f=k]bBh5#5 r(ˉ:%@z -J^99~M"_3Gg(^? 'Pk?zzO?ޗ6 lL eVͲT-FPG邗Fi8U/3b,p]tѮqN=hg;@v#*_~p"gIះxf ]wH [(En.ja4[h:\᠖áUSшaL% =qHjbKDa7EDzMOL>:jm^l0+`,0̀K2+fʼ16;-[KYzWz/^ îA\қr+w}րU~I>VP]ʣqf7e ,x\s19I8BwSI^e'%%]#~a!8" ~.uQ]FIɦ?8$r^@ M ê\PN&m!xhL#@EaS 6Q-*9 5FʫfWfGɍ `uæbf҈753%as\ρ6UqeXC ج lv;I ^*1*jF8Q{ǫq Rhh$i +Rۅӯ`K:41=(o ~WziBnF)5%lx[ߍ|qwQzVv1XlU(W6{\r5?bH$\dy-J{U{"hw(JDgZX?݂F[v؁SQ="(Pq 7XiTj.,i .cn{FFQDTɋ@& y *&LӻzP _>nXK^^7ӐwI ([44mm 6nCJ_A`wr QdUˋ oIJg50( `)>_z5(l1#B]7g<3m]{K4^b*a"*ƪ!\뜊rIgL#x ~Vg,\ϲfGS3x¸U1kklnF8VV1bֽ^zKr= a,ޒEWW6ix:fcSnHr',XvJ8$EU'8$Q$J U5ajzWc+>T-Df> 24Ȍf%FɏT0እ1A>:H~:%TE`q&%iRI!Ryo8:Kn {k n{FY$MAW0KÉ^5ji<9xq0Կ8mF9 LjRgEpK4X 4(I7I9!O႟qv%z#{ .Fec`il:wk8.|r%:酸$p@Hk[nü}wOk5샲l +Q$(qTG2uIx6J]B4lC2k!rMs:798++Y淀5ZgǑ ~G}>74p<BO<7BčI\?qI-޹r{ї;pH'9,I;1*~ls _b7 ݽ.߿f~p@#P^yva f 2٠x?w?e3粢}g&{ mVڡ vJNS:pY:8C/gCvq8@}s}' /2w8GTp釰p#oܙ ieGq,9( }:V$._9*>S εdު\MP(v4]wUAu6`;hl t g8 Zi MJ!ȤƒVu̡ZXd#K M"V;iA:oq?Ӌ+vQsTV+i}I<14;^ A JNK5L6J Nk~tz mŸ[)]tL;ȩ//K9JynMC̼5$ |`Q/aN{]!}`9TjX5NKwD90 endstream endobj 383 0 obj <> stream x][ ~7pwxV]a\ Р.p Mj/uiFNPd}v")RDRӧ/χׯ?{ㇿ}z=߿?<?}|O߼9.O78_1uP, r߾&\\ zg%gF؉ A/pa5!ʜɑ7+Fra"}|%ȣzA?nylUR.J<^?rb "A_9#*tRCӋbLM^I>#NӅ/^XAiy/@I߼|q~}><5x|4b(Ν(>%+nYrC:O}}@_/zb -"A P|aϫL%,LK gF(FϷ#18+z>qbv$nDmyD]E@H+c8G{W?a4#K)5l6@ޥkC q/G[=g$CMWA '3ZJπ|0*,O[#8Ȯ"FnF1ۊ0Q?:A0;&QX,J.֒,e?PLm]Po%C5?!</G Y啱 G{-IHUeRlNRd-Tc o"ew]@r4XDg3DH8^VSJ 7#jRjOLl*t̨=<d~ tNmV-/PA"&JU\tODQ!wn 3 1#>m'>̳ls6At`ɉ\DF᭭ǁ.3,,\!"b߸&NDh3Q14~e֢EÝSNL:gmGI{&XrYu 6wHBG^q3:?/~Pg}FUrdy_V'ֲb1iEc@PdKEa$@&\lbkGK!r/ʨc9+58&AR"=J?)Aj=-w[P>ǭ c!_6o ) mAuIWdG˦dM)ٶ(-1YS2ۙ^րL /#}\ǹQ/^Bw6Ͳھ3k_״u*^ox-; Gdړbc;ê|vUQW%+ $ZF[77/Ub$2m.ވeDzд7M1;ΘRpz"/;lbIRZ@%FK\ ՓȵZOlzOF%Q bM"ׂ(`ir$+o#0n:c>dlnayuaUS -'2Gx7u'cZu?u'3!O(o: 5Ix|ObQD*yztd.T/!#ުl:m"WQS RM/wΪT3UBWܻuc5PϓL}piVQ3'9mirqmN}*XZu endstream endobj 384 0 obj <> stream x]I$7݆;<4PUY5 X А%nYB .\lASU%  d󏟿zz}}9oo_>^>?~x~Ͽ|tY˧o^dN~|GO˅2doߐO}+Rl3'J`+]&D+93ӧz憬<;V )o߱;^~_(E)3@:SX%ի guF4\P0"e.)Wd!FOˆI[;7KP ;)-Oa1'(?}7۟^~0JĂȈӧ}G-X 3庤cu^bE? ɢu# ̢Q 5qEe לЫ4A\$~.1HuQ|=,3Oma\9;b !}wV?}<(p=TjIIo A~ p#Rвu GsAwuN&iVI3UVn()?)`l3O&M%F%&2ji5LI)1phYfEȼN~}'Y3ژvt%[,+ *p'R +)}Tk ͮAW~G'J 5a'JVE$. ?n}Kj5<8+Q(R-0a@kd-P;ogB")RM Ak8eq+#O*'SKWDG!Jf3tWq%^)3xv_ opaxSWbXD1zD ƂoiI~!lmr;.i:i$U>r5 ~i,yVЄV {zFg֏a&g]M]wc}*9c7ǩvc2HeN:i&e[deXޞ+SMeNa"7Er!f=fPt0,)g6sPyw&nD3Tk=I35J$^&3-<V5<%P%ܶ</3e72d t쫒1vl:pM"8=ᢘ,AylaѧfiÔ*f2+Nql6j|6kA͊$_[0ɭ+j9yUeڼavh449FWO}&bዘ_{{v/[r#Jc܍b4]5D'z]t'΂KD,:ЁGXX[O%c!`m!7It8WLmb֔l|EEf8l ۘO m ^cionu '8 m$ qZk Z5LCZ-k9B_i ce+%8X"r6e?o.6!Nb; QgqR`٘ D];wC<}3s- PI@c9+' A&x)kD (Ťl)QmV=ZwYK:LS*I;X>X#&X6&6iIMl5i013h٠.Ŭ}Cc5HBktmQBDK vmk(ⴒu*P+hdM*s/[@}FYfHUIlamUbj&# XZljnFjj!ԦXRq[hMmb\F9\0|"-م*v=hCE빽3ԒPa0Vô׷_MVԅblܱirs&[|\YUf: 4bn;4>4#&49&,weu{vAIj9w莙W[Id}goոZPg*V}m;f>.\3L/Bt[bdzm n#fvՆ dK0rjegPkªo~;҈ @%17fc( ݾdGĩ4dUgs Q0gU$D ݶ6o1;^ 2jˠ&0-`MF60E۳L* 7zL^m$Ji"h#NN0m$ pfCp Z׷'kAPvpJ̴v8Z'C~LtF'wR8Ն dG cy۳ GiS SXu%gizn@s,@MNTL@30CBۇf%(˯kIAmq4giG$D Mb͝LTT^[ڤAsvo3ZΠܬE ߨrcgzYd5lq@q]Xʒ*1*;ݾUZ$CcVSM|BĀYUf:J6X}lldz ،ڪfxFxkHHV mM e+w>eH7~mp%<wTIyNb +zMf+Py&rG+pKWU7Pf=N+Fw`; 3 'D.|̹{HXC\<>+ ۸h+ϻ Bq [seM!-קôylꎱXJ(|~ɭ \9&4pLBuTD邭R>zHot^1 KT00MMl' zR b 7 uQkw47#϶ u$m8NPkmͬrsg q>O0jƬ8+ڎN0AX]d\f(S'8ieI6;1qNbΝLT)Cu5aөLg@J7wbVCO!z+INJZ=2A*S D' XtN`Ԕ{'[1woyw~ͽworwe6f&@=F+̮ e}\|E)amHLJM󈥐wC&/k AVgޡNeyhIHj%9~6 f* 5cXogX1JvsN`bʍ)iVp˹oZ6I]0˸(.T؝Mԙ pvEJ. j[o +l/-M_n9ٵHB PP^,(gF&n4nk+b!sD)nJ$]D7R[>eG .̍ÈݽuČ|2T5fUP̹l8HnM|S1珔W쇣knxKP$ l\jpWvE#% D6%Y -{.`04 ;,ۙ|!+?'\ }jA+5Z84TLcnʁr%ˎ΁;MwND?/z G]?,`y("z7] pLe\UbF@[$o`f\̏y{=wF{5>9>_lXWO&w帝xn'ض3wm9؛06RIbmK <ޔG7ne@i#ͳ(U[I" F'm-3? ?<k^F`&_j1A{ endstream endobj 385 0 obj <> stream xXMH8vUu ]6^00d'2ò~5XRl O뮮MǃV7>yz8|y~Se]r^mvZP|P4x#hCju9}^-Tsm6`JjK5&r|pA[uN]߸+W.cL> 0n \; B,`YYbܐQ4 eL*0i qzjųV)_z~R۷ڜ0|><|eLV7jSWH4Rq`T3kCPm%jo_k-AcסA?amRxweJU Xt3py\a1kdpY6 8f̑5ə)pڈ)hr$2fo0Ov NfW.ؼ (qLngutcpM-9p 9x?!Ou>h$VIQ;) (r%Go Q/Lt(dqu6/˳@9)v[Cϰz:I=dI/وR M #+de}`2Ffh%FY6drzFu{q1ҜQQ %F,p1pQHo9C6*bS")f"8m bK^`T ( fFQtdg"ݙ98cT?BvQ&1?nEՅMg=S兑 8Dtq7gd-b BbdD#͇휪muu`Εg@U1TG|A-VtRNm)SLBJJ~o1ʄl3U-\K*ū44O4Ց80/ Y3ʞ)1F MgoMX |w=:IߔIM_Ph(#,TDt yNpNdflCҩ7{Π)ma<̒k{Aq34„Sm2J&Sg.pW{5gRj.Bm9+Yi\[e%+3"@c2|̄l5w'VL=ScX:':Bъ3 BV'#j:yw9%ɮiQcӎi(Svѹ&03(buk 78g}T endstream endobj 386 0 obj <> stream x}Me7ހ9W$ӈ,YN/{fM}ARߔye/IEӧoOO~??_??oo˷E_78_Nw<|߾xk~ͯ?ڼ -.iC*.#Żr:ӽ}gO* 9Cܯߟ߉-em*? I-׻9>(Kh ;8oX*LR򡈺ې]k{ֻ)"m%z,/Yq%yxJ4ersq_- I&XS>Ө~{ Kxr}>luR#6L{Rs υ +jN>rC&4_š_-" NELFq7uC ]8nc)itj!D<~16d BE /B$-e8aY'Iq0(0Ds08i`pb Z5 c`N);tGr k6Fyu8S!fA5afd, XS_<*u F ion,Δ թd3\7Z$ '|h !UP_JtlQ2ZKyü⵹H-*R<}4@Ph'*8Vgs<⿺$F:Fhk9#{O k7ă%[|?DW!ZmC'#F?ެ@te8bDtY9xq[XEb ꫰Cwly1yҰ#YWm.x}8FsRj$$Xc#LicLvfXlD|K(QgC=haDȥm۠;b$M !){Kg.xePCG}%O}sVr8tˣ5YzY&u} "O{Dh<~x=iK op*<'.tmgMe5/A>Z1Q,q ūLY!UWCA1?L ߵ=S7,2|'dDgtv+#~cP pD cq1HH@Ex, H8ęm`y#l-Q˄~zoMPTNsw(?[`rkfy3T3v9g/܅e`?e?BAs].ϑ5gRJY}= jJNq>O QX8Bg5C&(J@Nc/L^z8լumSt^&_V`32MdW Ab~cZ' 0VM3k`Bbgt,SB_rm\_dʹVk'"ÊT .N+R앣zI8g'{deO`f SW@kUnd q[`ȽV3aQl |8TP;Nqc&*{0^02o YͰV"Ѝ FIn,,pZ&wkuY+Lh4K׎Yq ԎFIh 19Mđ607U!r{`%5K!N N?ï〖 :!k.̕UCc)ꃽ4p3J$ybqj uq9YrVJܱQԬ)d VY)H{Ό< jzZCz&B;&f2M C֑1W70 AKثX^,>Hc28c|:c5:$lVj/Y,YV3 &qMa`H-rq}rIy}# Q9XJiˆgY@}c92gꭗ/R2MOy i,19pASeVԄcں\?Y$)_L8ןqLs2sl@Qs,MH&}D#bku4 IgPA S^ tA#HDa1XP.݀ :^eq y "A]֐άWu*'&CyKU+&rī|oU(eN?GS ʦ.T[I]ϖ !Wb޸+ސv@IVzzë ?㢖M+$ G]`CW Ux];GuR4+z~jS=  ?.m*d\2W=|A@ז6FQƮMԭ#ċin} 1 yjz' xûCxy<|@)IK1ðN]6>ϷNtdF]vA0vn߅x`bj!g%fLHUdj \N5A:95 2c& ذbB|~ĖQd V" mFI0isR X3=SrXKkDF=!"睵3&}U2^EgṗӱB8 >xQTFP1Ӈ:Ag0OzThО;`|Z 'O LwV2Ü#5#} {E(w LSg|ֈ/~>s@gM f^ cGvfM~Ö<::A{uu]l6]P~]17vYAtd;>jUQ:@P{Nm-skmU5 SA"g9騮IC;l.UO2zjgrd¸ 8uG j0uLbGbb,S;GehEPҎbeȨӍ`fSK !q dZ"r}qp]!bؚiQ,W̰frhÈp̮]:> T2lYT4?g##V$ynjȁc?Lw"ANOǼ@GIW$yV #NIU?`aEUCr&*(tAtE:$aa@2 p0I<$BӞ ]8SVxM<6T 2(kATg@ NU^ؑQ](![!fxo`TPa)bɹj{/XsC O l\q YM~Xy(h 6u\9.B̥w6Im̠*"[pH^@y\}EyP_וC{b=\g܂Ya]H=ʇj.iބ0<ن+TcbG}]s #18d01Жu $( ARiz33bt_c'(-eh #zTG06;{.t:Ž&\{ӏ634>SnOBQ6#_̾<ʛ(vHF`jʣ3 F`ok̂31NO= OC'5rBl1HJpr6u !{up ںq/6uБ;0Hro=pyB x+˷cg+r:eJ:e ߧB|0qڌ{֠x;5Gy.50l1!O 'm+H~eN|DŽ1Q$Y T}[){2h||oGіpo^||')e#Oy}vbhTReT0LWDwhˍ\rAwn]s7̇Ln@047;_,fLP^lO`ތakinY1ͲHRnqn6fd؀,fY>Lr#lZ~u +s,,C (5MaPsd1JL5ɪ4}X5o6fs2Xҧ !7mػYzY£f UvΛav|.GJtlNT_ffJ-ϓ fD5i6~q5${rkӮ3qI.cmЂM^gtGˏ߲EtJ1w~ύ%6@;+8V{OXA5KxpCĚ\;*FA>ߩ7Z^jJ 0[hNYYrxj@!79uA3p}g@ w \[AޅynAu>m >#0,g^탬ow~%hF Uy[j)=P YܯHX1Un MȄZԗ+ 46Ī_76K1tӸy4u  2ƢqX3|(<^rEu@7$vG!i[ r!LАi2 06h0BC3Lʭ1y(a,q 8!s aX4[0ycDy~<&= -@9<ᶃ!am 2 2y0 r>,'*c UY2Ӌ+)ν_Fg !J``%l n0@ V0qǜTy'*+ X fPA 8I&UFOv54 ZPӂȴ@ɴ2 G.BCl'S2a54 h MT L;1$FfJf[Ɩ mL2ug \=@rR`C,C|g񮿈wڶcП,}ch^5qgk/mЎݎg#ٛGG_?'xOvdE}"ó<Kǒrj;Ai~:M!XNg3wj~>m;sBLDT?'t_d# C|*q]9߃n繘2lP_1LF\Zp8\:m"KUX>xd` ˜X=0+n!=ܰ)g!,]jXe9JOӅcѐC\HofUuOtw\mEѴ2xSǽ]wdI:(Uw?a^3aXJ \.lj+1V'U@ 0DW 0sB14O~HMPte8=?SJeΏp7Wޘ J(`l=6H, EȁS}\@t:ʍGhH\aRk I%Z I{!*$T`buG}.Mdo]QPf2O̾ӸakՄ܏^ߡ=  miSkQ} %L:w4/4fFL3Hsi`ȰdU&Faa/Ť,(̺7 ì?|B@⃬zX4)NʣğMD3U{M,F<~'1R!D+Ȼe,sj4b{5ZqS' ;aؠ"A, *T0aPxg jT0 L\PA"Fv/oY"9`<: RTQq8ըFC)@R$ dڔiB V2MHe#j7)cdi̴1TN{[ul[x=+9F^ OL$:^@D;ZvP;vЯܝzjƯZ`V[# F: F_Q&.Mzw?Ǫ% |frAs%βJgG;7̿սұC3a X'6ڴ(5]z3ׅf4sT#O?G_ B,ҺsD Yy&ؕe6= ٰP/Eo zaƅ :7Aw8j C RQܠU 3@ odhp6 =٘W!'afk|^кE뗲Fy%Nk:^XomT'Ԝ hmlFu*v:FtNZïz텺ڨN2 % * ,׉1\+'C2ׇ pGبc7H;ܜ><]T':G|EJ2cnubpϱuW\"]ZO=NgeR#@M }jW+_ߢ=%}o_T;;bOs{we;PI  A9ULܖ-84壊;!"ym0nX]l,CWشA$t- 3T+0K{&J!-5]~g\l-(ꌖΆc.+.l0 0ZXD?wʇwhOJv|qѩ]w#.Iw| &nttU2d!Jg8*DiZe;'Rs>Ew'qwEٿ '~$q `V]:x;=3х~ xT8,*ڮLI:wzt8d`vPnjl6lzR8bVmV8nI„5!՗T>Խᇈ0c$4uV#’7Vy 7ƫvkJJq|Q]2뚆39t٤< {jm.Y֢o0ˆվ}7V[[J>?Tϥ*-Of\{p-S.N{eN]2v-s9U<"#\OVis{O} 3=TrmuF%*LAcwz0 f3iaMAGW 8(@BF>b_rjQ1t~WSn<$8?K'B\73ZhN߻9`'; w}g<8UѠ"YuuC|]zfnfUCY?]r>4[w.SqRopIrRW7^_(cR&9Gߪbp];BW;]MZ#r:Yn|Gnn;}y,\5r {/W\&Ԥ08`qt*s 9j~ D/v p|ڜa@0XCW7<5w9(]Zvnv@~s^nKzpƫ/z݀w\ n;R\qrU46suOsei< x,'DrWL(IuqEw))n[),)n7yS6Wta<)ی{KqgEקup7NqeiwڸwSg.זk^>?0D9rCĶ.$ǝ(bpp "ֿeqQ,2eqG8 0?`W:5CVhC]NJVhCk:m:k_?Oyxԭm(VVΞ^;aCMR5A.ԅtR۾]7/p A7yZjlsm>-mM>R u&;U^`ޏ;$5lE;'}ep[k;f[_ajB. {]O;S,sIUe۝#];hv w,E]wuxTO=GUM.|$i;=L+5Yd`v*55U>^K`.@Kj uvyoȱT{cզqbKxo-Džr- 8]8[k}v}&Cd?yåC7+0WXe$_#܃LnzJ]Ll8.t2?Үv^dkeP/c>@SSzI<=+Gb9u`,M]835̾N >᣶2tmfn%s(ѥW><'08x.3 lf`4E\XMDUh {UI$QW*~sz p]S.bߒK<> stream x=[^m`}0 76胓EI$X迯nѕy[,xHH?|ǿ~ݟw?>}<]/O߾J/Oo q -98|7g/߾yJreWՕɮʭx6hL~őXCNupY޽W~Ѳ,:p|QT\5WIcЧ'dLrs(U3v)X{r1i!vvo/.?$Iy6"8:o˷ϗ>O?aI-D`"_(iVOGʹ/~YW /?{Wٓj%.ZڈKQO#!?!(jN=IeVNIT(I'TT8EEy97vTJҫxWDR̃V#n&FUu8=qq0喲0ը10-TEìxuM ْmmHEmhOr:2@54[XqMӑ17υܠ=]Fg1O:7$R=l;3) c.a:YjՈgA\R1^;L8K1l[f9IDO.U>8Pdd,'CP$(϶60zHrկ^D*JvNLJLl)uy$tq@_Le&jTjF}md'@^)}$-XAJv2}j}>KTJ,'n30 KK{"nB sI KRiֵy0%f:M[ 5naPPܐ y%Ֆ ?'1]$TzGb 7Ho' (pY7m9Rw  MOBjPIJJ*8 sjn߼{O+JIߋ+*/nm5'}ܣsCSB>Tz)s&'!”.HąO;X,4ٗ^%erAbkAejҵ`M4[ߐ2۔ LaiԴRKM>GA)W]BjZfs?(${}&};3`TfYUF2M0$EN:AR++ $%M q &ON3N!BtH˼)dWS2J@YL7<A)2IvQ}nyRVaɬ&O^xɫӴ*gUs9mșJB1KrŨ43}-z aDS0>A$(З2L2 #aZfB^BӗuH[er^ ϏQ߬+=? wN`]j!w'UǢ#NqoR#3/䕰g#M)D?*\(}z u5l[@\Na \̺0qJ+]>'T=El;RqEK3dI*}@֘CO~$WBPBg`U^%/r! ]~e)v0YOUfF,+Ma ڴHT9DHPJY,w ՞5[a׾B D  ܩ븩?(FȈɴVo)sB:DǛkP&kY{N֢t4YZL;ULMtɡѰmxR6WǸ@v.ne'aB٦#4{RK8BrH)A Jdq޷' 'kO/Vio$ܺ;qiW)5@WwaSx.\xfmw EZ,Z-:w8-N%y7v8&Cwiyc=suh !pGuߍ#<Ϛ p@sDgcع)nB ʨQzcت{ݎG )XpO C bpեE8GLB& D61D"E2/ĥQ>n$_sUЁU a0!w3rV+29?ODA.kLڹ.TNesH&b*ݖ EAxONԜlc-i9fU#M»oG/yOVBJȍrw?ݢL88Z*ӣwpUH*b ACZ@c)2y"aat gE{*+A uqby[k&n%qͧŃOQ8= wɗUB SXC8n@P Τm&TTZ Ιۜv`rk0k W:8wJMn(hAuY^5 )Ä52MK:OG;"zȄ6F Y6B%WN^ 1GΉ"B<I .Λ0#v]pY]TUCC^6*g ujUC _ {8K |\ $!b1n X5ߞճ+!Fq+TŒ[?z5\4j"-T@.ϯfr5T^]uZSxEXR/p= Xq &;& v`UP B\e eb*ZT T ˤ ˦G2JO@ Ca̰m'ue(?BeS.1Rp-|Ԋk,O/[11+7=D# Dlxa6QTl ݂%'!"ǣ>k;a1I."i;fi:z~+97BGR@tX ]<k=dmU $%<hw‚_BS ~*TUXHѯd m% K&:Rrk#Ⱥh[P*mǚ|;q-L^w|Gïo޽׿{?LȄkve9O)Yl톭?WD6]2Dmc;"F!jY0׫Ձ3gi|@m Xԧ=67 Yߤ@LbY.Ld8"4Li#lƥ$dWlX x"8`@B' D(<1A2“4d@vg+0q 3lnEV N7oX^iD "b:"FqV@4CqDD#}'"EDDQJg7Eݼ, C|* p, nqWhL!!DĄ #qLSx@,QMb R> 1คY g@Kh@$7 >' 5"{RB pٷ 27V} (BM`e]6hnsAl# )""FAcUV^(7ҁ xH J$(/ j;vEVsƲy +Z4MQ4%@4*D5%(h `b m&Pڄ x̃`A 0Khרg"6;?#mz滎b'S[jqʳ}3&q3Tt6n% l1P؍E}GUM>a X'~?bv{9XoKP!YYC$.RKq؜EGU]n:6g˛f(tnY%ehRXJEC0'"tXD *%MFȿT[NF# g>bɩfQp" {f7WTP?ku׬Ao.tv.Ygr9TwcF#[gAuP|wh&ozĴ,YȦlҧ נ^5Z__-X=Ϸqx| {(56bX(cB.忥R*msAņ\lRǎIȪbӭbzf51m1 -hp$+mH*m'$F\)'s G\iS6[mݯ/2WdKc9DVhҥzZ +TGQTJr"e看@D 58: #0` @媍 jGHp;n]rsĨGֺIj bgM&8KNuJ\-^#oS˗}L:<-G.:pUa6oYk I@NG//d|IF,?sys?{L% ݻ??Mfu[0)g?ofFQwrXG`SdK;K /^7rV͐=՛&٥QklAtYK#<EC_~-Gu /4/ ~X_[~e$f߼k̃b#T'?- bh%bdaG"\F$% Q_o.̄p63'`yW]vr9![E̗z{xpY mc"&D_H/< Q&KBOSJ'"Ӄ  Vn[ AH/\@:YyYJ+5BEvr.O&W'b Ig(!yR)-# 7u;JF;7uEax ifOZqyYDeF;ؓF3b&%<ْ ʬ4Eͻ Yy7.RC{3FRo݀Ji|~(8#<Ϊ%?tLS?Y$whOL9MAlɭ OW8wp 9BSҨPi((ΖoDh_ZYl{y$UOPR81 @V_hÃ\R" [sGnLd؄Oţ|]T_yZW xUU,ƛp˽ҭҵvΪ3v[0#I_\QQ$0FSqSm 0 1]恓`|Dxm_˚LmFԷ 5|k`xT` 2ԌPwp%-a9԰ (_nP_svQXFyeD|OrEA8ʁљr x|J-vWTK +o٠;{y͢ݽ\dھj0w?(B/c{bl4>]PF@pVZ Y#@TIpPB@-[;g7;VLHTv|@y[6?/~m  N^sZPP1`\qZ ,҈C8CP==(h8Trde~D /YXƔXC*c y;'qg>R n%W~cvn`q$sDq$CCDB$ae0I'LoՉzB$-UxD3PɾjY(n /)95ONY^52VzMuWթIs$k÷jl/_Uj*DrghQN*/Yk(d%VI~i1"Dz⪂,հAQy7ƛL)&xS>bv Vѽ(Юo dH0޸GWfB|?I=?;i[> ɼd'S*# CO5  7AV@< ֭6~ .PQJW-VrɻFD~j[5Y~kp}:|:7mPprID޷aVhiKk?,5N4 i^xϧR{!,^XXpmKȽFanEn֭ ŀjiRL?)|ֺT?@ u4|B;1+EptU>t0b,s8.!~!4-Fh#34|:Ұ* lP/ M QEn@E(|j3RKszT'Āp @Q[PM'xP+^,0wybt;)xyd{0LUBKB#.!bѽR*q{y뗄k֫| 'Qw.3UЮYkYE;g ύ#XG؈} 7C $Sc=/U'N[<Qqq 4HQ=AaEuhfXTTGZ'=hREtP&hR0Xx/>-{ RO_eTdZjfx3PU68{Hڂ( u>4 NuՌN `IN*lQ:%J0Ym\ Pˮ'`),Du0Ԡ]0v!AAB0Ԓbٍ;sK0$&מ'rrc /;E endstream endobj 388 0 obj <> stream x=ۮem祀{t`8왢E$>y0R'C ҿD.J{I`ERE"J^˟y~>|o~~?{y}>0?"1bI1/_~÷L;W\wLIsL;KƬ{gw/ۗ_|"9ѐSܤ.~9nq,+cnp|իbξru7kj_=c{KƴL&/?Ss87ɰ'+.t#fW'XO_>&0